View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18693_low_36 (Length: 280)
Name: NF18693_low_36
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18693_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 274
Target Start/End: Original strand, 6222348 - 6222606
Alignment:
| Q |
16 |
caaaatacttaataatatgtggggatgatcctaaactttcaagtatttgtttctcgtttatgagagaatgggagccgtaagtatcagaggttttgacggc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
6222348 |
caaaatacttaataatatgtggggatgatcctaaactttcaagtatttgtttctcgtttatgagaaaatgggagccgtaagtatcagaggttttgactgc |
6222447 |
T |
 |
| Q |
116 |
ggtgagagacggaaagataccggaattctgtgggtgtgtggctaagttgacggtggcgaaggtgccactacctagcatcttacctcgaacccagttcttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6222448 |
ggtgagagacggaaagataccggaattctgtgggtgtgtggctaagttgacggtggcgaaggtgccactacctagcatcttacctcgaacccagttcttc |
6222547 |
T |
 |
| Q |
216 |
atgtttttgttactacgagatttttggtttggtttggtgtgttactctatattcttgga |
274 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
6222548 |
atgtttttgatactacgagatttttggtttggtttggtgtgttactctattttgttgga |
6222606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 6233124 - 6233182
Alignment:
| Q |
16 |
caaaatacttaataatatgtggggatgatcctaaactttcaagtatttgtttctcgttt |
74 |
Q |
| |
|
||||| |||| |||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
6233124 |
caaaacacttgataacatgtggggatgatcctaaacgatcgagtatttgtttctcgttt |
6233182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University