View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18693_low_38 (Length: 272)
Name: NF18693_low_38
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18693_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 1000233 - 1000469
Alignment:
| Q |
18 |
tatatcgcggaataacatattcattaatactcatcaaaattcattgctactaatattttaaacataataaagcaaataagttctagccaccaaggctcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1000233 |
tatatcgcggaataacatattcattaatactcatcaaaattcattgctactaatattttaaacataataaagcaaataagttctagccaccaaggctcaa |
1000332 |
T |
|
| Q |
118 |
aataacacatctttgtgaccattcttctcctcccctgattgatacgactcttctcccctgttttctacaactatgcgccaacagtccactctattatggc |
217 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1000333 |
aataacacatctctgtgaccatccttctcctcccctgattgatacgactcttctcccctgttttctacaactatgcgccaacagtccactctattatggc |
1000432 |
T |
|
| Q |
218 |
ctcatctcactgatatgatcattgaggatgatatact |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1000433 |
ctcatctcactgatatgatcattgaggatgatatact |
1000469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 88 - 129
Target Start/End: Original strand, 22221680 - 22221721
Alignment:
| Q |
88 |
agcaaataagttctagccaccaaggctcaaaataacacatct |
129 |
Q |
| |
|
||||||||||||| || | ||||||||||||||||||||||| |
|
|
| T |
22221680 |
agcaaataagttccagtctccaaggctcaaaataacacatct |
22221721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University