View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18693_low_39 (Length: 267)
Name: NF18693_low_39
Description: NF18693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18693_low_39 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 30107060 - 30107320
Alignment:
| Q |
1 |
tcctttgttgatgggtgtttatgcaaaagatgcttttagaaattttgttgagttgttacaaaagggtttaggtggtggtttgtttccacctgggatgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30107060 |
tcctttgttgatgggtgtttatgcaaaagatgcttttagaaattttgttgagttgttacaaaagggtttaggtggtggtttgtttccacctgggatgtct |
30107159 |
T |
 |
| Q |
101 |
ggtttgagtgttgtgtgtgttgaaaaggagattgtcgagtttgttaaggatggtgggagtgaggagaagatgggtttgaggtttaaggaagtggggtgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30107160 |
ggtttgagtgttgtgtgtgttgaaaaggagattgtcgagtttgttaaggatggtgggagtgaggagaagatgggtttgaggtttaaggaagtggggtgtg |
30107259 |
T |
 |
| Q |
201 |
aggtgaagaaatgtttgggtgctggtgttgttgttgggtttggagagattgaggttttggt |
261 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30107260 |
aggtggagaaatgtttgggtgctggtgttgttgttgggtttggagagattgaggttttggt |
30107320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 70 - 208
Target Start/End: Original strand, 28415 - 28553
Alignment:
| Q |
70 |
aggtggtggtttgtttccacctgggatgtctggtttgagtgttgtgtgtgttgaaaaggagattgtcgagtttgttaaggatggtgggagtgaggagaag |
169 |
Q |
| |
|
||||||||||| ||||||||||| ||| || |||| || |||||| || |||| ||||||||||| ||||||||||| | ||||||||| | ||||| |
|
|
| T |
28415 |
aggtggtggttggtttccacctgaaatggctcgttttagagttgtgagttttgataaggagattgttaagtttgttaagcaaggtgggagtaaagagaat |
28514 |
T |
 |
| Q |
170 |
atgggtttgaggtttaaggaagtggggtgtgaggtgaag |
208 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
28515 |
atgggtttgaggtttatggaattgggttgtgaggtgaag |
28553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University