View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18694_high_16 (Length: 276)
Name: NF18694_high_16
Description: NF18694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18694_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 259
Target Start/End: Original strand, 42361218 - 42361464
Alignment:
| Q |
14 |
atatgggactacatgtgcatatgtcattacatctgcaaccagcatcaggtaaactccnnnnnnnnn-aggataaaataaacataaataaccataagatgt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42361218 |
atatgggactacatgtgcatatgtcattacatctgcaaccagcatcaggtaaactccttttttttttaggataaaataaacataaataaccataagatgt |
42361317 |
T |
 |
| Q |
113 |
tataattaaggtgagccagaaatttacctgaattgaattagatgactgttaaactttggttaatttagtcaaaaattaattaaactaatttggctagtca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42361318 |
tataattaaggtgagccagaaatttacctgaattgaattagatgactgttaaactttggttaatttagtcaaaaattaattaaactaatttggctagtca |
42361417 |
T |
 |
| Q |
213 |
tcttgtcaagtaatatttgccatttcatcatgagagactgcgatact |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42361418 |
tcttgtcaagtaatatttgccatttcatcatgagagactgcgatact |
42361464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University