View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18694_high_5 (Length: 542)
Name: NF18694_high_5
Description: NF18694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18694_high_5 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (4 HSPs) |
 |  |  |
|
| [»] scaffold0517 (2 HSPs) |
 |  |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
| [»] scaffold0230 (1 HSPs) |
 |  |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0765 (1 HSPs) |
 |  |  |
|
| [»] scaffold0516 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 41)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 12213066 - 12212752
Alignment:
| Q |
1 |
tattattttggtcgatatacaatgaagtaagaaataattacgaaaactagttatacgaagacttacatagacgctttattggtctgtcaaaggatagcaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12213066 |
tattattttggtcgatgtacaatgaagtaagaaataattacgaaaactagttatacgaagacctacatagacgctttactggtctgtcaaaggatagcaa |
12212967 |
T |
 |
| Q |
101 |
aagtctagcaacagatacagtgataacaactttattgttctttttgaattcacaattatgattgtatacgctgctgggtattccatttggtttgcgtgac |
200 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
12212966 |
aagtctagcaacagatatagtgataataactttattgttctttttgaattcacaattatgattgtaaacgctgctgggtattccattttgtttgcgtgac |
12212867 |
T |
 |
| Q |
201 |
tgattttctgttcattcaaagtttgttgtgatgaaagcttatgcttgttatttctgttattattatgctacgctgctgaaatgtgaaacaatgttacact |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||| ||||| | ||||||||| |
|
|
| T |
12212866 |
tgattttctgttaattcaaagtttgttgtgatgaaagcttatgcttgttaattctgttattatt---ctacgcagctgaaatatgaaa-agtgttacact |
12212771 |
T |
 |
| Q |
301 |
gttatgaatcatgatggga |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12212770 |
gttatgaatcatgatggga |
12212752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 328 - 489
Target Start/End: Original strand, 42254956 - 42255120
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaa--attttgt |
424 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| |||||||| |||||||||| |||| || |||||||||| ||||||| |||||| |
|
|
| T |
42254956 |
aaggctaaaatatgcttttggtccctgtaaatatggcgagtttgagttttggtccctggtaaattttttttttgaaattcatctctgcaaatttttttgt |
42255055 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagat |
489 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||| ||| || |||||||||||| |
|
|
| T |
42255056 |
tttttaaaatagtcattggatccactttcttgctgatttgtcccatttctgcatatgtggcagat |
42255120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 35212066 - 35212127
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35212066 |
aaggctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctggtaa |
35212127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 329 - 439
Target Start/End: Original strand, 17066424 - 17066534
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaattttgttttt |
428 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17066424 |
aggctaaaatatgcttttaatccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaattgaaattcatccctgcaaaattttgttttt |
17066523 |
T |
 |
| Q |
429 |
taaaatagtcc |
439 |
Q |
| |
|
||||| |||| |
|
|
| T |
17066524 |
caaaatggtcc |
17066534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 328 - 452
Target Start/End: Complemental strand, 12385768 - 12385642
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||||||| ||||||||| ||||||||| |||||| ||||||||||||||||||| ||||||| |
|
|
| T |
12385768 |
aaggataaaatatgattttggtccctgcaaatatagcgagtttggattttggtccctggtaaaaaaaaatttgaaattcatccctgcaaaattttttgtt |
12385669 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcacttt |
452 |
Q |
| |
|
||||||||| |||||||| | |||||| |
|
|
| T |
12385668 |
ttttaaaattgtccttggccccacttt |
12385642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 32197969 - 32197909
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
32197969 |
aggctaaaatatgcttttggtccctgcaaatatagcgaatttgggttttggtccttggtaa |
32197909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 328 - 466
Target Start/End: Complemental strand, 36749308 - 36749167
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaa--ttttgt |
424 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||| |||||||||| | |||| ||||||||||||||||||| |||||| |
|
|
| T |
36749308 |
aaggctaaaatatgtttttggtcattgcaaatatgacgagtttgagttttggtccctagtaaatttttgttttgaaattcatccctgcaaaaaattttgt |
36749209 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
36749208 |
tttttaaaatagtctttggatccactttctcgctgatttgtc |
36749167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 331 - 389
Target Start/End: Complemental strand, 31489993 - 31489935
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
31489993 |
gctaaaatatgtttttggtccctgcaaatataacgagtttgggttttggtccttagtaa |
31489935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 329 - 466
Target Start/End: Complemental strand, 39619851 - 39619713
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaa--aattttgttt |
426 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||||||||||||| | |||||| || || |||||||||| |||||||| |
|
|
| T |
39619851 |
aggctaaaatatgcttttggtccatgcaaatatggcgagtttgggttttggttc-tggtaaaaattttttgtaattttatccctgcaattttttttgttt |
39619753 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
39619752 |
tttaaaatagtccttggactcactttcttaatgatttgtc |
39619713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 464
Target Start/End: Original strand, 12933418 - 12933558
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn---gaaattcatccctgcaaaa--ttttg |
423 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| ||||||||| |||||| ||||| ||||||||||||| ||||| |
|
|
| T |
12933418 |
aggctaaaatatgcttttggtccctgcaaatatagtgagtttgaattttggtccctggtaaaaaaaaaaaaattgaaatccatccctgcaaaaatttttg |
12933517 |
T |
 |
| Q |
424 |
ttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| ||||| |
|
|
| T |
12933518 |
ttttttaaaaaagtccttggcctcactttcttgcttatttg |
12933558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 344 - 503
Target Start/End: Complemental strand, 42255947 - 42255785
Alignment:
| Q |
344 |
tttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaat--tttgttttttaaaatagtcct |
440 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
42255947 |
tttggtccctgcaaatatgacgagtttgagttttggtccctggtaaaataaaattttgaaattcatccttgcaaaatattttgttttttaaaatagtctc |
42255848 |
T |
 |
| Q |
441 |
tgggctcactttcttgctgatttgtcccttttatgtttatgtggcagatacttactgtaccaa |
503 |
Q |
| |
|
| | | |||||||||||||||||||| | ||| | |||||||||||| || | |||||||| |
|
|
| T |
42255847 |
tagacacactttcttgctgatttgtctcatttcagcctatgtggcagatgctgattgtaccaa |
42255785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 329 - 381
Target Start/End: Original strand, 40576765 - 40576817
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtc |
381 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||| |||||||| |
|
|
| T |
40576765 |
aggctaaaatatgcttttggtccctgcaaatatgacgaatttggattttggtc |
40576817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 328 - 498
Target Start/End: Original strand, 5610154 - 5610328
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn--gaaattcatccctgcaaaatt--ttg |
423 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||| |||| |||||||||| ||| |||||| ||||| ||||||||||||||| || |
|
|
| T |
5610154 |
aaggttaaaatatgcttttgatccctgcaaatataacgaatttgggttttagtctctggtaaaaaaaaaaatttgaaatccatccctgcaaaattattta |
5610253 |
T |
 |
| Q |
424 |
ttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagatacttactgt |
498 |
Q |
| |
|
|||||||||||||| |||||| |||||| ||||||||||||| | ||| || ||||||||| ||||| ||||| |
|
|
| T |
5610254 |
ttttttaaaatagttcttgggtccacttttttgctgatttgtcacatttttgcttatgtggcccatactgactgt |
5610328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 328 - 464
Target Start/End: Original strand, 24195605 - 24195746
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt---aannnnnnnnnngaaattcatccctgcaaaa--tttt |
422 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||||||||||| ||| |||| || ||||| ||||| ||||||| |||| |
|
|
| T |
24195605 |
aaggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttgctccctggtaaaaaaaaaaaaattgaaatccatccttgcaaaatttttt |
24195704 |
T |
 |
| Q |
423 |
gttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||| ||||||| |
|
|
| T |
24195705 |
gttttttaaaaaagtccttggccccactttcttgttgatttg |
24195746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 332 - 389
Target Start/End: Complemental strand, 28462685 - 28462628
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
28462685 |
ctaaaatatgcttttggtctctgcaaatatgacgaatttgggttttgatccctggtaa |
28462628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 41693643 - 41693704
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
41693643 |
aaggctaaaatatgtttttgatccctgcaaatatggcgaatttgggttttggtccctggtaa |
41693704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 333 - 389
Target Start/End: Complemental strand, 32544830 - 32544774
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
32544830 |
taaaatatgattttggtccctgcaaatatagcgaatttgggttttggtccttggtaa |
32544774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 382
Target Start/End: Original strand, 36748198 - 36748249
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
36748198 |
ggctaaaatatgtttttggtccctgcaaatatga-gagtttgggttttggtcc |
36748249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 329 - 383
Target Start/End: Complemental strand, 30513340 - 30513286
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcct |
383 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||||| |||||||| |||||||||| |
|
|
| T |
30513340 |
aggctaaaatatgattttggtccttgcaaatatgatgagtttggattttggtcct |
30513286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 404 - 487
Target Start/End: Original strand, 39618730 - 39618815
Alignment:
| Q |
404 |
ttcatccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcag |
487 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||| | |||||||||| ||||||||| ||| ||| |||||||||| |
|
|
| T |
39618730 |
ttcatccctgcaaatttttttgtattttaaaatagtccttggacccactttcttgatgatttgtcttatttttgtctatgtggcag |
39618815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 329 - 382
Target Start/End: Complemental strand, 5611567 - 5611514
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
5611567 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttcgtcc |
5611514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 11217132 - 11217071
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||| |||||||| ||||||||| |||||| |
|
|
| T |
11217132 |
aaggttaaaatatgcttttggtccctgcaaatatagcgagtttgaattttggtccctggtaa |
11217071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 13418948 - 13419009
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||| ||||||| ||||||| |||||| |
|
|
| T |
13418948 |
aaggctaaaatatgtttttggtccctgcaaatattgcgaatttgggtattggtccctggtaa |
13419009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 330 - 386
Target Start/End: Original strand, 6589021 - 6589077
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttgg |
386 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| | |||| ||||||||||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccttgg |
6589077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 24197163 - 24197103
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| |||| |||||||| | |||||| |
|
|
| T |
24197163 |
aggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggttcctggtaa |
24197103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 25046300 - 25046240
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||| ||||||| | ||||||||| |||||| |
|
|
| T |
25046300 |
aggctaaaatatgattttggtccttgcaaatatggcgagtttagattttggtccatggtaa |
25046240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 31848204 - 31848144
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
31848204 |
aggctaaaatatgtttttagtccctgcaaatatagcgaatttgggttttggtccctggtaa |
31848144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 333 - 389
Target Start/End: Original strand, 32543483 - 32543539
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||| ||| ||||||| | ||||||||||||| |||||||||| |
|
|
| T |
32543483 |
taaaatatgcttttggtccctacaaatatagcaagtttgggttttgatccttggtaa |
32543539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 489
Target Start/End: Original strand, 36748268 - 36748359
Alignment:
| Q |
400 |
gaaattcatccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagat |
489 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||||| ||| | |||||| ||||||||||||| | ||| || |||||||||||| |
|
|
| T |
36748268 |
gaaattcatctctgcaaaattttttgttttctaaaatagtctctggacccacttttttgctgatttgtctcatttttgcctatgtggcagat |
36748359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 419 - 466
Target Start/End: Original strand, 37784072 - 37784119
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
|||| |||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
37784072 |
ttttattttttaaaatagtccttggaccaactttcttgctgatttgtc |
37784119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 554243 - 554297
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
554243 |
aaggctaaaatataatattggtccctgcaaatatagcgagtttgggttttggtcc |
554297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 335 - 389
Target Start/End: Original strand, 25037755 - 25037809
Alignment:
| Q |
335 |
aaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
25037755 |
aaatatgattttagtccctgcaaatatgacgagtttgaattttggtccctggtaa |
25037809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 419 - 489
Target Start/End: Original strand, 32543570 - 32543640
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagat |
489 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||||||| | ||| || ||||||||||||| |
|
|
| T |
32543570 |
ttttgttttttaaaatagtccctgagtacactttcttgctgatttgaatcatttttgcttatgtggcagat |
32543640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 419 - 465
Target Start/End: Complemental strand, 32544741 - 32544695
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttgt |
465 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
32544741 |
ttttgttttttaaaatagtcattgggtctactttcttgctgatttgt |
32544695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 38742179 - 38742233
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||| ||||||||| |||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
38742179 |
aaggttaaaatatgtttttagtccctgcaaatatagcgagtttgggttttggtcc |
38742233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 464
Target Start/End: Original strand, 25037840 - 25037885
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||| |||| ||| || |||||||||||||||||| |
|
|
| T |
25037840 |
ttttgttttttaaaaaagtctttgagcccactttcttgctgatttg |
25037885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 385
Target Start/End: Original strand, 35837922 - 35837979
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttg |
385 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| | |||| |||||| ||||||| |
|
|
| T |
35837922 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttg |
35837979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 464
Target Start/End: Complemental strand, 41695015 - 41694877
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
||||||||||||| |||| | ||||||||||| |||||||| |||||||||| |||| || ||||| ||||||||||||| ||||||| |
|
|
| T |
41695015 |
aggctaaaatatgtttttcatccctgcaaatatagcgagtttgagttttggtccctggtaaaaaatatttttgaaatccatccctgcaaaattttttgtt |
41694916 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||| |||| ||| | |||||||||| ||||||| |
|
|
| T |
41694915 |
ttttaaaaaagtctttgaccccactttcttgttgatttg |
41694877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 330 - 382
Target Start/End: Original strand, 28528905 - 28528957
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| | ||||||||||| |||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtcc |
28528957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 328 - 384
Target Start/End: Original strand, 46304084 - 46304140
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcctt |
384 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| | |||| |||||| |||||| |
|
|
| T |
46304084 |
aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcctt |
46304140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 385
Target Start/End: Original strand, 46759657 - 46759713
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttg |
385 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| | |||| |||||| ||||||| |
|
|
| T |
46759657 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttg |
46759713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 2e-28; HSPs: 44)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 328 - 498
Target Start/End: Complemental strand, 42447848 - 42447675
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaatttt--gt |
424 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | ||||||||||||||||| |||||| ||||||||||||||||||||||| || |
|
|
| T |
42447848 |
aaggctaaaatatgcttttgattcctgcaaatacggttagtttgggttttggtccctggtaaaataaaattttgaaattcatccctgcaaaattttttgt |
42447749 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagatacttactgt |
498 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| ||| || |||||| ||||| || ||||| |
|
|
| T |
42447748 |
tttttaaaatagtccttggacccactttcttgctgatttgtcccatttttgcctatgtgacagatgctgactgt |
42447675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 329 - 466
Target Start/End: Complemental strand, 52403184 - 52403043
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa-nnnnnnnnnngaaattcatccctgcaa---aattttgt |
424 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||| ||| ||||||||||||| |||||| |
|
|
| T |
52403184 |
aggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccctggtaatttttttttttgaatttcatccctgcaatttttttttgt |
52403085 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
52403084 |
tttttaaaatagtccttggacccactttcttgatgatttgtc |
52403043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 389
Target Start/End: Complemental strand, 977905 - 977846
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
977905 |
ggctgaaatatgcttttggtccctgcaaatatgacgagtttgggttttggtccttggtaa |
977846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 329 - 466
Target Start/End: Original strand, 42446525 - 42446665
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgc--aaaattttgtt |
425 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||| | || || ||||||||||||||| ||||||||||| |
|
|
| T |
42446525 |
aggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtcgatagtaaaagaaatttttgaaattcatccctgcaaaaaattttgtt |
42446624 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
|||||||||||||||| | | || ||||||| ||||||||| |
|
|
| T |
42446625 |
ttttaaaatagtcctttgacccaatttcttgttgatttgtc |
42446665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 328 - 463
Target Start/End: Original strand, 52401015 - 52401153
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaa--attttgt |
424 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||||||||||||||| |||| || ||| |||||||||||||| |||||| |
|
|
| T |
52401015 |
aaggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctggtaaattttttttttgaatttcatccctgcaaatttttttgt |
52401114 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgattt |
463 |
Q |
| |
|
||||||||||||||| ||| | |||||||||| |||||| |
|
|
| T |
52401115 |
tttttaaaatagtccatggacccactttcttgatgattt |
52401153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 331 - 389
Target Start/End: Complemental strand, 20489416 - 20489358
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20489416 |
gctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctggtaa |
20489358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 328 - 438
Target Start/End: Complemental strand, 40477435 - 40477322
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa-nnnnnnnnnngaaattcatccctgcaaaa--ttttgt |
424 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||||||||||||||| | |||| ||||||||||||||||||| |||||| |
|
|
| T |
40477435 |
aaggctaaaatatgattttggtccctgcaaatataacgagtttgggttttggtccctagtaatttttttttttgaaattcatccctgcaaaattttttgt |
40477336 |
T |
 |
| Q |
425 |
tttttaaaatagtc |
438 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40477335 |
tttttaaaatagtc |
40477322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 331 - 442
Target Start/End: Complemental strand, 48035790 - 48035676
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaa--ttttgtttt |
427 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||||||||||| ||||||||| |||| || ||||||||||||||||||| |||||| || |
|
|
| T |
48035790 |
gctaaaatatgtttttgatccctgcaaatatgacgagtttggattttggtccctggtaaatttcttttttgaaattcatccctgcaaaattttttgtatt |
48035691 |
T |
 |
| Q |
428 |
ttaaaatagtccttg |
442 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48035690 |
ttaaaatagtccttg |
48035676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 39820664 - 39820604
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
39820664 |
aggctaaaatatggttttggtccctgcaaatatagcgagtttgggttttggtccctggtaa |
39820604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 443
Target Start/End: Original strand, 4705681 - 4705799
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn---gaaattcatccctgcaaaatttt--gt |
424 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||| ||||||||||| |||||| ||||| ||||||||||||||||| || |
|
|
| T |
4705681 |
ggctaaaatatgcttttgatccctgcaaatatggcgagtttaggttttggtccctggtaatttttttctttttgaaatccatccctgcaaaattttttgt |
4705780 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgg |
443 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4705781 |
tttttaaaatagtccttgg |
4705799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 381
Target Start/End: Complemental strand, 52708676 - 52708625
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtc |
381 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
52708676 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtc |
52708625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 329 - 382
Target Start/End: Complemental strand, 38505639 - 38505586
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||| |||||||||| |
|
|
| T |
38505639 |
aggctaaaatatgcttttgctccctgcaaatatggcgagtttgagttttggtcc |
38505586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 53121300 - 53121361
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
53121300 |
aaggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaa |
53121361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 333 - 389
Target Start/End: Original strand, 22508738 - 22508794
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
22508738 |
taaaatatgattttggtccctgcaaatatagcgagtttgagttttggtccttggtaa |
22508794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 400 - 464
Target Start/End: Original strand, 39819383 - 39819449
Alignment:
| Q |
400 |
gaaattcatccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||| ||||||||||||||||| |||||| |||| ||||||||| | |||||||||||||||||| |
|
|
| T |
39819383 |
gaaatccatccctgcaaaattttttgtttttcaaaaaagtccttggccccactttcttgctgatttg |
39819449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 332 - 389
Target Start/End: Original strand, 20488368 - 20488425
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
20488368 |
ctaaaatatgtttttggtccctgcaaatatggtgaatttgggttttggtccctggtaa |
20488425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 43734102 - 43734049
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtc |
381 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
43734102 |
aaggctaaaatatgcgtttggttcttgcaaatatagcaagtttgggttttggtc |
43734049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 329 - 464
Target Start/End: Complemental strand, 45268630 - 45268492
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaatttt--gtt |
425 |
Q |
| |
|
||||||||||||| |||| | ||||||||||| | ||||||||||||||||| |||||| ||||| ||||||||||||||||| ||| |
|
|
| T |
45268630 |
aggctaaaatatgtttttaatccctgcaaatatagcaagtttgggttttggtccctggtaaaaaaaaattttgaaatccatccctgcaaaattttttgtt |
45268531 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||| ||| | |||||||||||| ||||| |
|
|
| T |
45268530 |
ttttaaaatagtcattgaccccactttcttgcttatttg |
45268492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 329 - 382
Target Start/End: Original strand, 46026075 - 46026128
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| ||||||||| ||||||||| |
|
|
| T |
46026075 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtcc |
46026128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 46027478 - 46027417
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| |||||||| ||||||||| |||||| |
|
|
| T |
46027478 |
aaggctaaaatatacttttggtccctgcaaatatagcgagtttgaattttggtccctggtaa |
46027417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 47433869 - 47433809
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| ||| |||| |||||||||| |||||| |
|
|
| T |
47433869 |
aggctaaaatatggttttggtccctgcaaatatagcgaatttgagttttggtccctggtaa |
47433809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 401 - 442
Target Start/End: Original strand, 48033133 - 48033176
Alignment:
| Q |
401 |
aaattcatccctgcaaaa--ttttgttttttaaaatagtccttg |
442 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48033133 |
aaattcatccctgcaaaaatttttgttttttaaaatagtccttg |
48033176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 441
Target Start/End: Original strand, 51004213 - 51004256
Alignment:
| Q |
400 |
gaaattcatccctgcaaaa--ttttgttttttaaaatagtcctt |
441 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51004213 |
gaaattcatccctgcaaaattttttgttttttaaaatagtcctt |
51004256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 43641143 - 43641202
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||| || |||||| |||||| |
|
|
| T |
43641143 |
ggctaaaatatgcttttagtccctgcaaatatagcgagtttggattatggtccctggtaa |
43641202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 46104343 - 46104402
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||||| ||||| |||| |||||| |
|
|
| T |
46104343 |
ggctaaaatatgattttggtccctgcaaatatagcgagtttgagtttttgtccctggtaa |
46104402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 48033058 - 48033117
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||| |||||||| ||||||||| |||||| |
|
|
| T |
48033058 |
ggctaaaatatgtttttggtccttgcaaatatggtgagtttggattttggtccctggtaa |
48033117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 389
Target Start/End: Complemental strand, 32637246 - 32637188
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||| |||| |||| | ||||||||||||||||| | |||||| |
|
|
| T |
32637246 |
gctaaaatatgcttttggtccctgtaaatgtagcgagtttgggttttggttcctggtaa |
32637188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 381
Target Start/End: Original strand, 40476222 - 40476272
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtc |
381 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
40476222 |
gctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtc |
40476272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 389
Target Start/End: Original strand, 45267306 - 45267364
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||| ||||| | ||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
45267306 |
gctaaaatatgtttttgatccctgcaaatatagcgagtttgagttttggtccctggtaa |
45267364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 406 - 464
Target Start/End: Complemental strand, 977827 - 977767
Alignment:
| Q |
406 |
catccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||| | |||||| ||| ||||||| |
|
|
| T |
977827 |
catccctgcaaaattttttgttttttaaaatagtcattggccccactttattgatgatttg |
977767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 382
Target Start/End: Complemental strand, 20585704 - 20585651
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||| ||||||||| ||||||||| |
|
|
| T |
20585704 |
aggctaaaatatgtttttgatccctgcaaatatagcgagtttggattttggtcc |
20585651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 28942907 - 28942846
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| | |||| |||||| |||| |||||| |
|
|
| T |
28942907 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggtaa |
28942846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 385
Target Start/End: Original strand, 35639505 - 35639562
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttg |
385 |
Q |
| |
|
|||||||||||||||||||||| | || |||||| | |||||| ||||||||||||| |
|
|
| T |
35639505 |
aaggctaaaatatgcttttggtccttgaaaatatagcaagtttgagttttggtccttg |
35639562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 464
Target Start/End: Complemental strand, 41780777 - 41780732
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||||| ||| | ||||||||||||||||| |
|
|
| T |
41780777 |
ttttgttttttaaaatagtccatggacctactttcttgctgatttg |
41780732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 377
Target Start/End: Original strand, 44506580 - 44506629
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggtttt |
377 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||| |||||| |
|
|
| T |
44506580 |
aaggctaaaatatggttttagtccctgcaaatataacgagttttggtttt |
44506629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 464
Target Start/End: Complemental strand, 46027388 - 46027339
Alignment:
| Q |
415 |
aaaattttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||| |||||||||||||| ||||| || || |||||||||||||||||| |
|
|
| T |
46027388 |
aaaaatttgttttttaaaacagtccctgagcccactttcttgctgatttg |
46027339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 468
Target Start/End: Complemental strand, 53632775 - 53632726
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttgtccc |
468 |
Q |
| |
|
|||| |||||||||||||||| | | | |||||||||||||||||||||| |
|
|
| T |
53632775 |
ttttattttttaaaatagtccctagacccactttcttgctgatttgtccc |
53632726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 382
Target Start/End: Complemental strand, 54437527 - 54437474
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| ||| |||| |||||||||| |
|
|
| T |
54437527 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttggtcc |
54437474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 419 - 463
Target Start/End: Complemental strand, 7208639 - 7208595
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgattt |
463 |
Q |
| |
|
|||||||||||||||||||| |||| | |||||||||||| |||| |
|
|
| T |
7208639 |
ttttgttttttaaaatagtcattggacacactttcttgcttattt |
7208595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 28427244 - 28427304
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| | |||| |||||| |||| |||||| |
|
|
| T |
28427244 |
aggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggtaa |
28427304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 34238597 - 34238657
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| | |||| |||||| ||||||||||| |
|
|
| T |
34238597 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaa |
34238657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 419 - 463
Target Start/End: Original strand, 35639600 - 35639644
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgattt |
463 |
Q |
| |
|
||||||||||||||| ||| ||||| | ||||||||||||||||| |
|
|
| T |
35639600 |
ttttgttttttaaaaaagttcttggccccactttcttgctgattt |
35639644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 328 - 376
Target Start/End: Original strand, 42444035 - 42444083
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttt |
376 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||| | ||||||||||| |
|
|
| T |
42444035 |
aaggttaaaatatgtttttggtccctgcaaatatggcaagtttgggttt |
42444083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 328 - 380
Target Start/End: Complemental strand, 44507860 - 44507808
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggt |
380 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
44507860 |
aaggctaaaatatgattttggtccctgcaaatatagcgagtttgaattttggt |
44507808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 329 - 486
Target Start/End: Original strand, 202578 - 202738
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaa-ttcatccctgcaaaatttt--gtt |
425 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| ||||| ||| ||||||||||||||||||| ||| |
|
|
| T |
202578 |
aggctaaaatatgcttttggtccctgcaaatataacgagtttggattttggtcccgggtaaattttttttttaaaattcatccctgcaaaattttttgtt |
202677 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggca |
486 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| | | ||| || |||||||||| |
|
|
| T |
202678 |
ttttaaaatagtccctggactcactttcttgctgatttggcacctttttgcttatgtggca |
202738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 4e-24; HSPs: 36)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 328 - 487
Target Start/End: Complemental strand, 24611178 - 24611016
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaa--ttttgt |
424 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||||||||||||| |||||||||| |||||| ||| ||||||||||||||| |||||| |
|
|
| T |
24611178 |
aaggctaaaatatgtttttggtccctgtaaatatgacgagtttgagttttggtccctggtaaaataaaattttgaatttcatccctgcaaaaatttttgt |
24611079 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcag |
487 |
Q |
| |
|
|||| |||||||||||||| | |||||||||| ||||||||| | ||| ||| |||||||||| |
|
|
| T |
24611078 |
ttttcaaaatagtccttggacccactttcttgatgatttgtctcatttttgtctatgtggcag |
24611016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 328 - 388
Target Start/End: Original strand, 50164401 - 50164461
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggta |
388 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
50164401 |
aaggctaaaatatgcttttggtccctgcaaatatggcgagtttgagttttggtccttggta |
50164461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 328 - 464
Target Start/End: Original strand, 26863858 - 26863997
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaa--ttttgt |
424 |
Q |
| |
|
||||||||||| || ||||||| ||||||||||| ||| |||| |||||||||| |||||| |||| |||||||||||||| |||||| |
|
|
| T |
26863858 |
aaggctaaaatgtgtttttggtccctgcaaatatagcgaatttgagttttggtccctggtaaattttttttttgaaaatcatccctgcaaaaatttttgt |
26863957 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
26863958 |
tttttaaaatagtccttgggcccactttattgctgatttg |
26863997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 9774949 - 9774888
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
9774949 |
aaggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggtaa |
9774888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 13074635 - 13074574
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
13074635 |
aaggctaaaatatatttttggttcctgcaaatatgacgagtttgagttttggtccctggtaa |
13074574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 39163084 - 39163024
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
39163084 |
aggctaaaatatgcttttggtccctgcaaatatggcgaggttgggttttggtccctggtaa |
39163024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 330 - 466
Target Start/End: Original strand, 24609919 - 24610058
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaa--ttttgttt |
426 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||||||||||| | || || ||| ||||||||||||||| |||||||| |
|
|
| T |
24609919 |
ggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctagtaaataaattttttgaatttcatccctgcaaaattttttgttt |
24610018 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
||||||||||||| | | | |||||| ||| ||||||||| |
|
|
| T |
24610019 |
tttaaaatagtccctcgccccacttttttggtgatttgtc |
24610058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 35911949 - 35911888
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
35911949 |
aaggctaaaatatgcttttggtccctgcaaatatagcgaatttggattttggtccttggtaa |
35911888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 333 - 439
Target Start/End: Original strand, 9774040 - 9774149
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa-nnnnnnnnnngaaattcatccctgcaaaa--ttttgtttttt |
429 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||| |||||||||| |||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
9774040 |
taaaatatgtttttggtccctgcaaatataacgagtttgagttttggtccctggtaatttttttttttgaaattcatccctgcaaaattttttgtttttt |
9774139 |
T |
 |
| Q |
430 |
aaaatagtcc |
439 |
Q |
| |
|
|||||||||| |
|
|
| T |
9774140 |
aaaatagtcc |
9774149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 27264276 - 27264216
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
27264276 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttggtccctggtaa |
27264216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 34934807 - 34934747
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
34934807 |
aggctaaaatatgctttttgtccctgcaaatatagcgaatttgggttttggtccttggtaa |
34934747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 35721100 - 35721160
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
35721100 |
aggctaaaatatgtttttggtccctgcaaatataacgaatttgggttttggtccctggtaa |
35721160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 464
Target Start/End: Original strand, 20722472 - 20722607
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgtttt |
427 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||| ||||||||||||||| |||||| |||| ||||||||||||| |||||| || |
|
|
| T |
20722472 |
ggctaaaatgtgcttttggtccctgcaaatatagcgaatttgggttttggtccctggtaaaaaaaaaattgaaa-acatccctgcaaaattttttgtctt |
20722570 |
T |
 |
| Q |
428 |
ttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |
|
|
| T |
20722571 |
ttaaaatagtccttggatccactttattgctgatttg |
20722607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 406 - 466
Target Start/End: Original strand, 30722193 - 30722255
Alignment:
| Q |
406 |
catccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
30722193 |
catccctgcaaaattttttgttttttaaaatagtccctggacccactttcttgctgatttgtc |
30722255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 389
Target Start/End: Complemental strand, 37396899 - 37396840
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
37396899 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtccttggtaa |
37396840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 328 - 464
Target Start/End: Original strand, 47038864 - 47039003
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaa--ttttgt |
424 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| | ||||||||||||||||| |||| || ||| | ||||||||||||| |||||| |
|
|
| T |
47038864 |
aaggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggtaaaaaaaaattttgaattccatccctgcaaaaatttttgt |
47038963 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||| | |||||||| | ||||||| |
|
|
| T |
47038964 |
tttttaaaatagtccttggacccactttctagttgatttg |
47039003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 17977620 - 17977559
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
17977620 |
aaggcttaaatatggttttggtccctgcaaatatagcgaatttgggttttggtccttggtaa |
17977559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 27262906 - 27262967
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
27262906 |
aaggctaaaatatgtttttggtccctgcaaatatagcgagtttgtgttttggtccctggtaa |
27262967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 330 - 464
Target Start/End: Complemental strand, 46075109 - 46074975
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaattttgttttt |
428 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||| ||||||||||||||||||| |||| || |||||| |||||||| ||||||| || || |
|
|
| T |
46075109 |
ggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaaattgaaattaatccctgc-aaatttttttgtt |
46075011 |
T |
 |
| Q |
429 |
taaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||| ||| | |||||||||||| ||||| |
|
|
| T |
46075010 |
taaaatagtccctggacccactttcttgcttatttg |
46074975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 39162823 - 39162883
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaat-atgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||| |||||||||||| ||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
39162823 |
ggctaaattatgcttttggtccctgcaaataatggcgagtttggattttggtccttggtaa |
39162883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 17976761 - 17976820
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
17976761 |
ggcttaaatatggttttggttcctgcaaatatagcgaatttgggttttggtccctggtaa |
17976820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 329 - 458
Target Start/End: Original strand, 46073884 - 46074015
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaa--attttgttt |
426 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| | | |||||||||| |||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
46073884 |
aggctaaaatatgcttttgatccctgcaaatatagcaaatttgggttttagtccctggtaaatttttttttgaaattcatccctgcaaatttttttgttt |
46073983 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgct |
458 |
Q |
| |
|
| |||| ||||||||| ||||| |||| |||| |
|
|
| T |
46073984 |
tctaaattagtccttgagctcattttcctgct |
46074015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 48589022 - 48588968
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
48589022 |
aaggctaaaatatgtttttggtccctgtaaatatggtgagtttgggttttggtcc |
48588968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 378
Target Start/End: Complemental strand, 48594109 - 48594059
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttg |
378 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
48594109 |
aaggctaaaatatgtttttggtccctgtaaatatggcgagtttgggttttg |
48594059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 378
Target Start/End: Complemental strand, 48598720 - 48598670
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttg |
378 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
48598720 |
aaggctaaaatatgtttttggtccctgtaaatatggcgagtttgggttttg |
48598670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 11710551 - 11710612
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||| | |||| |||||| ||||| |||||||||||||| |||||| |
|
|
| T |
11710551 |
aaggctaaaatatgtttttgatccctgtaaatataacgaggttgggttttggtccctggtaa |
11710612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 487
Target Start/End: Complemental strand, 20723749 - 20723587
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaatttt--gt |
424 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||| |||| ||||| |||| |||||| ||||| ||||||||||||||||| || |
|
|
| T |
20723749 |
aaggctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttagtccctggtaaaaataaattttgaaatccatccctgcaaaattttttgt |
20723650 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcag |
487 |
Q |
| |
|
|||||||||||||||||| | |||||| || ||||||| ||| ||| || |||||||||| |
|
|
| T |
20723649 |
tttttaaaatagtccttgaccccactttactgatgatttggcccatttttgcatatgtggcag |
20723587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 37395631 - 37395692
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
37395631 |
aaggctaaaatatgtttttggtccctgcaaatatagcgtatttgggttttggtccctggtaa |
37395692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 30724075 - 30724015
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| || | |||| |||||||||| |||||| |
|
|
| T |
30724075 |
aggctaaaatatgcttttcgtccctgcaaatataacaaatttgagttttggtccctggtaa |
30724015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 441
Target Start/End: Original strand, 51240195 - 51240238
Alignment:
| Q |
400 |
gaaattcatccctgcaaaa--ttttgttttttaaaatagtcctt |
441 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51240195 |
gaaattcatccctgcaaaattttttgttttttaaaatagtcctt |
51240238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 389
Target Start/End: Complemental strand, 23470028 - 23469969
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||| ||||||| ||| |||||| |
|
|
| T |
23470028 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttcggttttgatccctggtaa |
23469969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 408 - 439
Target Start/End: Complemental strand, 37545872 - 37545841
Alignment:
| Q |
408 |
tccctgcaaaattttgttttttaaaatagtcc |
439 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37545872 |
tccctgcaaaattttgttttttaaaatagtcc |
37545841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 385
Target Start/End: Original strand, 15058419 - 15058473
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttg |
385 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| |||| |||||| ||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttg |
15058473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 401 - 464
Target Start/End: Original strand, 48856282 - 48856347
Alignment:
| Q |
401 |
aaattcatccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||| |||||| |||| ||||||||||||||||||||| | |||||| ||| ||||||| |
|
|
| T |
48856282 |
aaattcatccatgcaaatttttttgttttttaaaatagtccttggccccactttattgatgatttg |
48856347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 378
Target Start/End: Complemental strand, 2604187 - 2604138
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttg |
378 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| |||||||||||||| |
|
|
| T |
2604187 |
aggctaaaatatgtttttagtccctgcaaatatggggagtttgggttttg |
2604138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 365
Target Start/End: Complemental strand, 48153044 - 48153007
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacg |
365 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
48153044 |
aaggctaaaatatgcttttgctccctgcaaatatgacg |
48153007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 4e-21; HSPs: 32)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 328 - 486
Target Start/End: Complemental strand, 22534783 - 22534622
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaa--ttttgt |
424 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||||||||| |||| || ||| |||| |||||||||| |||||| |
|
|
| T |
22534783 |
aaggctaaaatatgcttttgatccctgcaaatatagcgagtttgggttttggtccctggtaaaatttttttttgaatttcaaccctgcaaaattttttgt |
22534684 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggca |
486 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||||| | | ||| || |||||||||| |
|
|
| T |
22534683 |
tttttaaaaaagtccttggacccactttcttgctgatttggctcatttttgcttatgtggca |
22534622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 328 - 466
Target Start/End: Original strand, 10292814 - 10292954
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||||||| ||| |||| |||||| |||||| ||| ||||||||||||||||||| ||||||| |
|
|
| T |
10292814 |
aaggctaaaatatgattttggtcccttcaaatatagcgaatttgcgttttgatccttgataaaaaaatttttgaaattcatccctgcaaaaaattttgtt |
10292913 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
10292914 |
ttttaaaataatccttggatccactttcttgctgatttgtc |
10292954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 10717120 - 10717180
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
10717120 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggtaa |
10717180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 10718508 - 10718448
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
10718508 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggtaa |
10718448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 328 - 464
Target Start/End: Original strand, 22533315 - 22533453
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaa-ttttgtt |
425 |
Q |
| |
|
|||||||||||||||||||||| |||| | |||| ||||||||||||||||||| |||| || ||| ||||||||||||||| ||||||| |
|
|
| T |
22533315 |
aaggctaaaatatgcttttggtccctgtatatatagcgagtttgggttttggtccctggtaaaaaaaatttttgaatttcatccctgcaaaatttttgtt |
22533414 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
22533415 |
ttttaaaaaagtccctggatccactttcttgctgatttg |
22533453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 331 - 464
Target Start/End: Original strand, 28996835 - 28996971
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaattttgt--ttt |
427 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||||| | ||| |
|
|
| T |
28996835 |
gctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctggtaaaaaaaagttttgaaattcatccctgcaaaattttttatttt |
28996934 |
T |
 |
| Q |
428 |
ttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||||||| | |||||| ||| ||||||| |
|
|
| T |
28996935 |
ttaaaatagtccttggacccactttattgatgatttg |
28996971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 329 - 486
Target Start/End: Original strand, 38658480 - 38658639
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaa--attttgttt |
426 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| ||| ||||||||||||||| |||||| ||||| |||||||||||| |||||||| |
|
|
| T |
38658480 |
aggctaaaatatgcttctggtccatgcaaatatagcgaatttgggttttggtccctggtaaaaaaaaaattgaaatccatccctgcaaatttttttgttt |
38658579 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggca |
486 |
Q |
| |
|
|||||||||||| |||| | |||||| ||| ||||||| | | |||||| ||||||||| |
|
|
| T |
38658580 |
tttaaaatagtctttggccccactttattgatgatttggcacatttatgcctatgtggca |
38658639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 466
Target Start/End: Original strand, 14197823 - 14197962
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaattttgt-tt |
426 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||| | |||| ||| |||||||||||||| |||| | || |
|
|
| T |
14197823 |
aaggctaaaatatgtttttggtccctgcaaatatggcgagtttggattttggtccctagtaaaaaaaaaattgaatttcatccctgcaaatttttttatt |
14197922 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
||| ||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
14197923 |
ttttaaatagtccatggatccactttcttgatgatttgtc |
14197962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 463
Target Start/End: Original strand, 36588220 - 36588358
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaatt-catccctgcaaaatttt--gt |
424 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||| |||||||||| |||||| |||| ||||||||||||||||| || |
|
|
| T |
36588220 |
aaggctaaaatatgcttttggtccctgcaaatatagcgagtttgcgttttggtccctggtaaaaaaaaaatttgaattacatccctgcaaaattttttgt |
36588319 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgattt |
463 |
Q |
| |
|
|||||||||| |||| ||| | |||||| |||||||||| |
|
|
| T |
36588320 |
tttttaaaatggtccctggacccacttttttgctgattt |
36588358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 36589448 - 36589387
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
36589448 |
aaggctaaaatatgattttagttcctgcaaatatagcgagtttaggttttggtccttggtaa |
36589387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 464
Target Start/End: Complemental strand, 38456790 - 38456652
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | | ||| ||||||||||| |||||| ||||||||||||||||||| ||||||| |
|
|
| T |
38456790 |
aggctaaaatatgcttttggtccctgcaaatatagcaaatttaggttttggtccctggtaaaaaaaaaatttgaaattcatccctgcaaaattttttgtt |
38456691 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||||| |
|
|
| T |
38456690 |
ttttaaaatagtccctagatccactttcttgctgatttg |
38456652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 442
Target Start/End: Original strand, 6783576 - 6783692
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaatttt--gtt |
425 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| || |||| ||||||||||| |||| ||||||||||||||||||||||| ||| |
|
|
| T |
6783576 |
aaggctaaaatatgtttttggtcactgcaaatatggtgaatttgaattttggtccttcgtaattttttttttgaaattcatccctgcaaaattttttgtt |
6783675 |
T |
 |
| Q |
426 |
ttttaaaatagtccttg |
442 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6783676 |
ttttaaaatagtccttg |
6783692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 330 - 522
Target Start/End: Complemental strand, 4184038 - 4183843
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaa--ttttgttt |
426 |
Q |
| |
|
||||||||||||||||| || ||||||||||| | |||||||||||||||| |||||| ||||| |||||||||||| |||||||| |
|
|
| T |
4184038 |
ggctaaaatatgcttttagtccctgcaaatatagtgcgtttgggttttggtccctggtaatatttttttttgaaatcgatccctgcaaaaaattttgttt |
4183939 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagatacttactgtaccaatttgaacacgtggcgcaca |
522 |
Q |
| |
|
||||||| ||||| ||| | |||||||||||| ||||| | | ||| || ||| |||| || | | |||||||||| ||||||| |||||||||| |
|
|
| T |
4183938 |
tttaaaaaagtccctggacccactttcttgctaatttggcacatttttgcttaggtggtagctgatgactgtaccaacttgaacatgtggcgcaca |
4183843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 415 - 489
Target Start/End: Original strand, 18326599 - 18326673
Alignment:
| Q |
415 |
aaaattttgttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagat |
489 |
Q |
| |
|
|||| |||||||||||||||||||| || || |||||||||| ||||||||||| ||| || |||||||||||| |
|
|
| T |
18326599 |
aaaaatttgttttttaaaatagtccctgagcccactttcttgttgatttgtcccatttctgcctatgtggcagat |
18326673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 329 - 387
Target Start/End: Complemental strand, 45518020 - 45517962
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt |
387 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
45518020 |
aggctaaaatatgcttttggtccctgcaagtatagcgagtttgggttttggtccctggt |
45517962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 333 - 439
Target Start/End: Complemental strand, 3484843 - 3484743
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaattttgttttttaaa |
432 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
3484843 |
taaaatatgcttttggttcctgcaaatatagcgagttt------tggtccctggtaaaaaaaaatttgaaattcatccctacaaaattttgttttttaaa |
3484750 |
T |
 |
| Q |
433 |
atagtcc |
439 |
Q |
| |
|
||||||| |
|
|
| T |
3484749 |
atagtcc |
3484743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 22272331 - 22272270
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
22272331 |
aaggctaaaatatgcttttggtccccgcaaatatagcgaatttgggttttggtccctggtaa |
22272270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 28998052 - 28998000
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
28998052 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtcc |
28998000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 331 - 382
Target Start/End: Complemental strand, 39440480 - 39440429
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||| |||||||||| |
|
|
| T |
39440480 |
gctaaaatatgcttttggtccttgcaaatatggcgagtttgagttttggtcc |
39440429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 389
Target Start/End: Original strand, 4182623 - 4182681
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||| |||| |||||| ||| ||||||||||||||| |||||| |
|
|
| T |
4182623 |
gctaaaatatgcttttggtccctgtaaatatagcgaatttgggttttggtccctggtaa |
4182681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 415 - 489
Target Start/End: Complemental strand, 10293796 - 10293722
Alignment:
| Q |
415 |
aaaattttgttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagat |
489 |
Q |
| |
|
||||||||||||||||||||||||||| | || ||||||||||||||||| | |||||| |||||| ||||| |
|
|
| T |
10293796 |
aaaattttgttttttaaaatagtccttaaacccattttcttgctgatttgtctcatttatgcatatgtgacagat |
10293722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 377
Target Start/End: Complemental strand, 38659934 - 38659885
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggtttt |
377 |
Q |
| |
|
|||| ||||||||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
38659934 |
aaggttaaaatatgcttttggttcgtgtaaatatgacgagtttggatttt |
38659885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 39439922 - 39439983
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| | |||||| ||||||| || |||||| |
|
|
| T |
39439922 |
aaggctaaaatatgattttggtccctgcaaatatggctagtttgagttttggaccctggtaa |
39439983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 30124283 - 30124223
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | |||||| |||||||||| |||||| |
|
|
| T |
30124283 |
aggctaaaatatgcttttggtccctgcaaataaagcaagtttgagttttggtccctggtaa |
30124223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 489
Target Start/End: Original strand, 41846717 - 41846808
Alignment:
| Q |
400 |
gaaattcatccctgcaaaa--ttttgttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagat |
489 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| | | |||||| |||| ||||||||| ||| || ||||||| |||| |
|
|
| T |
41846717 |
gaaattcatccctgcaaaaatttttcttttttaaaatagtccttagacccacttttgtgctaatttgtcccatttttgcctatgtggtagat |
41846808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 3483635 - 3483685
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
3483635 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtcc |
3483685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 16644046 - 16643985
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||| |||| |||||| |||| |||||| |
|
|
| T |
16644046 |
aaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggtaa |
16643985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 464
Target Start/End: Original strand, 22271032 - 22271081
Alignment:
| Q |
415 |
aaaattttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||||||||| | | | |||||| ||||||||||| |
|
|
| T |
22271032 |
aaaattttgttttttaaaatagtccctagacccactttgttgctgatttg |
22271081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 1420501 - 1420449
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||| | ||||||| |
|
|
| T |
1420501 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttggatattggtcc |
1420449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 400 - 441
Target Start/End: Original strand, 14711603 - 14711646
Alignment:
| Q |
400 |
gaaattcatccctgcaaaa--ttttgttttttaaaatagtcctt |
441 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14711603 |
gaaattcatccctgcaaaattttttgttttttaaaataatcctt |
14711646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 22270942 - 22271002
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||| ||||| |||| |||| |||||| |
|
|
| T |
22270942 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttggattttagtccctggtaa |
22271002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 400 - 465
Target Start/End: Complemental strand, 41357354 - 41357287
Alignment:
| Q |
400 |
gaaattcatccctgcaaaa--ttttgttttttaaaatagtccttgggctcactttcttgctgatttgt |
465 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| ||||||| |||||| ||||||||| |||||||| |
|
|
| T |
41357354 |
gaaatgcatccctgcaaaaaattttgttttttgaaatagttattgggcctactttcttgatgatttgt |
41357287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 49; Significance: 9e-19; HSPs: 2)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 329 - 443
Target Start/End: Original strand, 29728 - 29845
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||| ||||||||| |||| || ||||||||||||||||||| ||||||| |
|
|
| T |
29728 |
aggctaaaatatgcttttggtccctgcaaataaaacgagtttggattttggtccctggtaaaaaaaaaatttgaaattcatccctgcaaaaatttttgtt |
29827 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgg |
443 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29828 |
ttttaaaatagtccttgg |
29845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 30967 - 30907
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
30967 |
aggctaaaatatggttttggtccctgcaaatatagtgagtttgggttttggtccctggtaa |
30907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 9e-19; HSPs: 42)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 329 - 452
Target Start/End: Original strand, 19674413 - 19674538
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgttt |
426 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||| |||||||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
19674413 |
aggctaaaatatgcttttggtccttgcaaatatagcgagtttgagttttggtccctggtaattttttttttgaaattcatccctgcaaaattttttgttt |
19674512 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcacttt |
452 |
Q |
| |
|
||||||| ||||||||| | |||||| |
|
|
| T |
19674513 |
tttaaaaaagtccttggccccacttt |
19674538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 329 - 463
Target Start/End: Original strand, 45618284 - 45618420
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgc--aaaattttgttt |
426 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||||||||||||||||| |||||| ||| | ||||||||| |||||||||||| |
|
|
| T |
45618284 |
aggctaatatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaattgaattacatccctgcaaaaaattttgttt |
45618383 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgattt |
463 |
Q |
| |
|
||||||| |||||||| | |||||| |||||||||| |
|
|
| T |
45618384 |
tttaaaacggtccttggacccacttttttgctgattt |
45618420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 328 - 464
Target Start/End: Complemental strand, 3880557 - 3880419
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgc--aaaattttgtt |
425 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||| | |||| ||| || |||||||| ||||||||||| |
|
|
| T |
3880557 |
aaggctaaaatatgtttttggttcctgcaaatatagcgagtttgggttttggtccctagtaaaaaaaaaattgaattttatccctgcaaaaaattttgtt |
3880458 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||| ||||| ||| | || |||||| |||||||| |
|
|
| T |
3880457 |
ttttaaaaaagtccctggacccattttcttactgatttg |
3880419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 330 - 442
Target Start/End: Complemental strand, 19675679 - 19675566
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgtttt |
427 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||| ||||||||| || ||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
19675679 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttggattttggtccctgataa-aaaaaatttgaaattcatccctacaaaattttttgtttt |
19675581 |
T |
 |
| Q |
428 |
ttaaaatagtccttg |
442 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19675580 |
ttaaaatagtccttg |
19675566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 401 - 498
Target Start/End: Original strand, 29415623 - 29415722
Alignment:
| Q |
401 |
aaattcatccctgcaaaattttgt--tttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagatacttactgt |
498 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||||||||||||| | ||| ||||||||||||||||| ||| ||| |||||||||||| || ||||| |
|
|
| T |
29415623 |
aaattcatccctgcaaatttttttaatttttaaaatagtccttggacccaccttcttgctgatttgtcctatttctgtctatgtggcagatgctgactgt |
29415722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 464
Target Start/End: Original strand, 16573376 - 16573514
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| ||| |||||||||||||| ||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
16573376 |
aaggctaaaatatgcttttggtctctacaaatatggcgaatttgggttttggtctctggtatttttttttttgaaatccatccctgcaaaattttttgtt |
16573475 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||| |||| | |||||| ||| ||||||| |
|
|
| T |
16573476 |
ttttaaaatagtctttggccccactttattgatgatttg |
16573514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 464
Target Start/End: Complemental strand, 54121760 - 54121622
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnnga-aattcatccctgcaaaat--tttgtt |
425 |
Q |
| |
|
||||||||||||| ||||| | |||||||||| | ||||||||||||||||||| |||||| ||||||||| |||||||| |||||| |
|
|
| T |
54121760 |
aggctaaaatatgattttgctccctgcaaatacggcgagtttgggttttggtccctggtaaaaaaaaaaaatttaattcatccttgcaaaatattttgtt |
54121661 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
54121660 |
ttttaaaatagttcttaggcccactttcttgctgatttg |
54121622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 34659704 - 34659758
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
34659704 |
aaggctaaaatatgcttttggtccctgcaaatatggcgagttaaggttttggtcc |
34659758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 329 - 464
Target Start/End: Original strand, 3879085 - 3879227
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa-----nnnnnnnnnngaaattcatccctgcaaaa--ttt |
421 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||| ||||||||| |||||| ||| ||||||||| ||||| ||| |
|
|
| T |
3879085 |
aggctaaaatatgcttttgatccctgcaaatatagcgagtttggattttggtccctggtaaattttttttttttttgaatttcatccctacaaaattttt |
3879184 |
T |
 |
| Q |
422 |
tgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
3879185 |
tattttttaaaaaagtccttggactcactttcttgctgatttg |
3879227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 333 - 389
Target Start/End: Complemental strand, 17371901 - 17371845
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||| | ||||||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
17371901 |
taaaatatgcttttgatccctgcaaatataacgaatttgggttttggtccctggtaa |
17371845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 41933817 - 41933877
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| |||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
41933817 |
aggctaaaatatgattttggtctctgcaaatatagcgagtttgggttttggtccttagtaa |
41933877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 419 - 487
Target Start/End: Original strand, 41933910 - 41933978
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcag |
487 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| || | | ||| || ||||||||||| |
|
|
| T |
41933910 |
ttttgttttttaaaatagtccttgaactcactttcttgctgatgtggctcatttttgcttatgtggcag |
41933978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 333 - 381
Target Start/End: Complemental strand, 41935126 - 41935078
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtc |
381 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
41935126 |
taaaatatgtttttggtccctgcaaatataacgagtttgggttttggtc |
41935078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 22204055 - 22204114
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
22204055 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaa |
22204114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 400 - 464
Target Start/End: Original strand, 42358103 - 42358169
Alignment:
| Q |
400 |
gaaattcatccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||| | ||||||||| || ||||| |
|
|
| T |
42358103 |
gaaatccatccctgcaaaattttttgttttttaaaatagtccttggacccactttcttacttatttg |
42358169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 330 - 389
Target Start/End: Complemental strand, 42359405 - 42359346
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||| ||||||||| |||||| |
|
|
| T |
42359405 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtccctggtaa |
42359346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 330 - 466
Target Start/End: Complemental strand, 32699373 - 32699234
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaattttgt--tt |
426 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||| ||||||||||||||||||| | ||| ||||||| ||||||||||||||| | || |
|
|
| T |
32699373 |
ggctaaaatatgtttttggtccctgtaaatatagcgagtttgggttttggtccctcataaaaaaaaaatttgaaattcgtccctgcaaaattttttattt |
32699274 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||||||||| |
|
|
| T |
32699273 |
tttaaaatagtccctaggcccacttttttgctgatttgtc |
32699234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 415 - 484
Target Start/End: Original strand, 32698081 - 32698150
Alignment:
| Q |
415 |
aaaattttgttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtgg |
484 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |||||| ||||||||||||| | ||| || |||||||| |
|
|
| T |
32698081 |
aaaattttattttttaaaatagtcattgggtccacttttttgctgatttgtcacatttttgcttatgtgg |
32698150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 329 - 382
Target Start/End: Original strand, 33134890 - 33134943
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||||||||||||| | ||||||| |
|
|
| T |
33134890 |
aggctaaaatatgtttttgatccctgcaaatatgacgagtttggatattggtcc |
33134943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 33137289 - 33137228
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
33137289 |
aaggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccctggtaa |
33137228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 419 - 464
Target Start/End: Complemental strand, 41935036 - 41934991
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| ||||||||||| |
|
|
| T |
41935036 |
ttttgttttttaaaatagtccttggacccactttgttgctgatttg |
41934991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 406 - 463
Target Start/End: Complemental strand, 29060863 - 29060804
Alignment:
| Q |
406 |
catccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgattt |
463 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | ||| | ||||||||||||||||| |
|
|
| T |
29060863 |
catccctgcaaaattttttgttttttaaaatagttcatggacccactttcttgctgattt |
29060804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 30091115 - 30091055
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
30091115 |
aggctaaaatatggttttggtccatgcaaatatgacgagtttaagttttgatccatggtaa |
30091055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 489
Target Start/End: Original strand, 45533364 - 45533455
Alignment:
| Q |
400 |
gaaattcatccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagat |
489 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| || | |||||||||||| ||| ||| | |||||| |||||||||||| |
|
|
| T |
45533364 |
gaaattcattcctgcaaaattttttgttttttaaaatagtctctgaacccactttcttgcttattagtctcgtttatgcctatgtggcagat |
45533455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 40198575 - 40198633
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
40198575 |
aaggctaaaatatgcttttc---cctgcaaatatagcgagtttgggttttggtccctggtaa |
40198633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 5827975 - 5827921
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| |||| |||||| |||| |
|
|
| T |
5827975 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
5827921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 13631601 - 13631547
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| |||| |||||| |||| |
|
|
| T |
13631601 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
13631547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 362
Target Start/End: Complemental strand, 31812215 - 31812181
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatg |
362 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
31812215 |
aaggctaaaatatggttttggttcctgcaaatatg |
31812181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 362
Target Start/End: Original strand, 42848025 - 42848059
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatg |
362 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
42848025 |
aaggctaaaatatggttttggttcctgcaaatatg |
42848059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 382
Target Start/End: Original strand, 4211560 - 4211613
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| | |||| ||||||||||| |
|
|
| T |
4211560 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
4211613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 369
Target Start/End: Complemental strand, 5259212 - 5259171
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtt |
369 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
5259212 |
aaggctaaaatatgtttttggtccctgcaaatatggcgagtt |
5259171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 382
Target Start/End: Complemental strand, 12152494 - 12152441
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| | |||| ||||||||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtcc |
12152441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 382
Target Start/End: Original strand, 14487801 - 14487854
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| | |||| ||||||||||| |
|
|
| T |
14487801 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
14487854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 332 - 381
Target Start/End: Original strand, 16916069 - 16916118
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtc |
381 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
16916069 |
ctaaaatatacttttggtccctgcaaatatggtgagtttgagttttggtc |
16916118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 17281569 - 17281630
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| ||| ||||| ||||||||| |||||| |
|
|
| T |
17281569 |
aaggctaaaatgtgcttttagtccctgcaaatatagcgaatttggattttggtccctggtaa |
17281630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 17370071 - 17370132
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| ||| ||||| ||||||||| |||||| |
|
|
| T |
17370071 |
aaggctaaaatgtgcttttagtccctgcaaatatagcgaatttggattttggtccctggtaa |
17370132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 29060943 - 29060882
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
29060943 |
aaggctaaaatatgtttttaatccctgcaaatatagcgagtttgaattttggtccttggtaa |
29060882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 464
Target Start/End: Original strand, 34659798 - 34659843
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| ||| ||||||| |
|
|
| T |
34659798 |
ttttgttttttaaaatagtctttggcctcactttattgatgatttg |
34659843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 333 - 385
Target Start/End: Original strand, 29597747 - 29597799
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttg |
385 |
Q |
| |
|
||||||||| | ||||| |||||||||||||| | ||||| |||||||||||| |
|
|
| T |
29597747 |
taaaatatgttattggtccctgcaaatatgaccaatttggattttggtccttg |
29597799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 341 - 389
Target Start/End: Complemental strand, 44706412 - 44706364
Alignment:
| Q |
341 |
gcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| ||| |||||| |
|
|
| T |
44706412 |
gcttttggtcactgtaaatatgacgagtttgggttttgatccctggtaa |
44706364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 45619791 - 45619731
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| ||||||| ||||||| ||| |||||| |
|
|
| T |
45619791 |
aggctaaaatatgtttttagtccctgcaaatatagcgagtttaggttttgttccctggtaa |
45619731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 330 - 382
Target Start/End: Original strand, 46292392 - 46292444
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| | |||| ||||||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
46292444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 330 - 389
Target Start/End: Complemental strand, 121044 - 120985
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
121044 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttgggttttggtccctggtaa |
120985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 119593 - 119652
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| |||| |||||||||| |||||| |
|
|
| T |
119593 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtccctggtaa |
119652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 3e-18; HSPs: 24)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 330 - 389
Target Start/End: Complemental strand, 1778849 - 1778790
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
1778849 |
ggctaaaatatgcttttggttcctgcaaatatagcgactttgggttttggtccttggtaa |
1778790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 329 - 522
Target Start/End: Original strand, 25977869 - 25978065
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |||||| ||||| |||||||||||| ||||||| |
|
|
| T |
25977869 |
aggctaaaatatgtttttggtccctgcaaatatagtgagtttgggttttggtccctggtaatatttttttttgaaatcgatccctgcaaaaaattttgtt |
25977968 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagatacttactgtaccaatttgaacacgtggcgcaca |
522 |
Q |
| |
|
|||||||| ||||| ||| | |||||||||||||||||| | | ||| || ||| |||| || | | |||||||||| ||||||| |||||||||| |
|
|
| T |
25977969 |
ttttaaaaaagtccctggacccactttcttgctgatttggcacatttttgcttaggtggtagctgatgactgtaccaacttgaacatgtggcgcaca |
25978065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 332 - 389
Target Start/End: Original strand, 21573938 - 21573995
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
21573938 |
ctaaaatatgcttttggtccctgcaaatatgacaagtttgatttttggtccttggtaa |
21573995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 464
Target Start/End: Complemental strand, 25979312 - 25979174
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaa--attttgtt |
425 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||| ||||||||||||||| |||||| ||||| ||||||| ||| ||||||| |
|
|
| T |
25979312 |
aaggctaaaatatgtttttggtccctgcaaatatagcgaatttgggttttggtccctggtaaaaaaaaatttgaaatcaatccctgtaaatttttttgtt |
25979213 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||| ||||||||| | || ||||||||||||||| |
|
|
| T |
25979212 |
ttttaaaaaagtccttggccccattttcttgctgatttg |
25979174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 407 - 464
Target Start/End: Original strand, 43824241 - 43824298
Alignment:
| Q |
407 |
atccctgcaaaattttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
43824241 |
atccctgcaaaattttgttttttaaaatagtctttggatccactttcttgctgatttg |
43824298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 1777467 - 1777528
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
1777467 |
aaggctaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtccctggtaa |
1777528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 329 - 489
Target Start/End: Original strand, 23861751 - 23861913
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaa--aattttgttt |
426 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| |||||||| ||||||||| |||||| ||||| ||||||||||| |||||||| |
|
|
| T |
23861751 |
aggctaaaatatgtttttggtccctgcaaatatggagagtttggattttggtccctggtaaaaaaaaatttgaaatccatccctgcaattttttttgttt |
23861850 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagat |
489 |
Q |
| |
|
||||||||||||| ||| |||||| ||| ||||||| || ||| | ||||||||||||| |
|
|
| T |
23861851 |
tttaaaatagtccatggatccactttattgttgatttggaccatttttacttatgtggcagat |
23861913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 30843642 - 30843703
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
30843642 |
aaggctaaaatatgcttttaatcactgcaaatataacgagtttgggttttggtccctggtaa |
30843703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 2412488 - 2412428
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
2412488 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaa |
2412428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 332 - 486
Target Start/End: Complemental strand, 23863107 - 23862950
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnn-gaaattcatccctgcaaaatttt--gttttt |
428 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||||||| ||| | |||| ||||| ||||| ||||||||||| |||||| |
|
|
| T |
23863107 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttgatccctagtaaaaaaaaaaattgaaatccatccttgcaaaattttttgttttt |
23863008 |
T |
 |
| Q |
429 |
taaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggca |
486 |
Q |
| |
|
||||||||| |||| | |||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
23863007 |
caaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggca |
23862950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 400 - 464
Target Start/End: Original strand, 36836537 - 36836603
Alignment:
| Q |
400 |
gaaattcatccctgcaaaa--ttttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| || | |||||||||||| ||||| |
|
|
| T |
36836537 |
gaaattcatccctgcaaaaaattttgttttttaaaatagtccctgaacccactttcttgcttatttg |
36836603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 8809594 - 8809656
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcct-gcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
8809594 |
aaggctaaaatatgtttttggtcccttgcaaatataacgaatttgggttttggtccctggtaa |
8809656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 415 - 464
Target Start/End: Complemental strand, 24749571 - 24749522
Alignment:
| Q |
415 |
aaaattttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
24749571 |
aaaattttgttttttaaaacggtccttggacccactttcttgctgatttg |
24749522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 11087049 - 11087108
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||| |||| | ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
11087049 |
ggctaaaatatgattttaatccctgcaaatatagcgagtttggcttttggtccttggtaa |
11087108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 406 - 466
Target Start/End: Original strand, 11087128 - 11087190
Alignment:
| Q |
406 |
catccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | | | |||||||||||||||||||| |
|
|
| T |
11087128 |
catccctgcaaaattttttgttttttaaaatagtctcttgacccactttcttgctgatttgtc |
11087190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 378
Target Start/End: Complemental strand, 3924927 - 3924877
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttg |
378 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||| ||||||||| ||||| |
|
|
| T |
3924927 |
aaggctaaaatatgcttttgctccttgcaaatatggcgagtttggattttg |
3924877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 362
Target Start/End: Complemental strand, 17302145 - 17302111
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatg |
362 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
17302145 |
aaggctaaaatatggttttggttcctgcaaatatg |
17302111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 18113087 - 18113141
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| | ||||| |||||| |||| |
|
|
| T |
18113087 |
aaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtcc |
18113141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 333 - 463
Target Start/End: Complemental strand, 36837834 - 36837703
Alignment:
| Q |
333 |
taaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgtttttta |
430 |
Q |
| |
|
|||||||| ||||||| |||||||||| ||||||||||||||||||| |||||| ||||| ||||||||||||| |||||||||||| |
|
|
| T |
36837834 |
taaaatatatttttggtctctgcaaatatagcgagtttgggttttggtccctggtaa-aaaaaaaatgaaatccatccctgcaaaattttttgtttttta |
36837736 |
T |
 |
| Q |
431 |
aaatagtccttgggctcactttcttgctgattt |
463 |
Q |
| |
|
|||||||| ||| | ||||||| |||| |||| |
|
|
| T |
36837735 |
aaatagtctttgaacccactttcgtgcttattt |
36837703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 404 - 486
Target Start/End: Complemental strand, 1590883 - 1590799
Alignment:
| Q |
404 |
ttcatccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggca |
486 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| || |||||||||| ||||||| | | ||| ||||||||||||| |
|
|
| T |
1590883 |
ttcatccctgcaaaattttttgttttttaaaaaagtccctgaatccactttcttgttgatttggctcatttttgtttatgtggca |
1590799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 464
Target Start/End: Complemental strand, 3924832 - 3924787
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| ||| ||||||| |
|
|
| T |
3924832 |
ttttgttttttaaaatagtccttggccccactttattgatgatttg |
3924787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 331 - 380
Target Start/End: Original strand, 25282408 - 25282457
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggt |
380 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||| |||||||| |||||||| |
|
|
| T |
25282408 |
gctaaaatatgtttttggtccctgtaaatatgtcgagtttgagttttggt |
25282457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 328 - 376
Target Start/End: Complemental strand, 24754219 - 24754171
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttt |
376 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
24754219 |
aaggttaaaatatgtttttggtccctgcaaatatggcgaatttgggttt |
24754171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 43788857 - 43788917
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| | |||| |||||| ||||||||||| |
|
|
| T |
43788857 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaa |
43788917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 21)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 330 - 464
Target Start/End: Complemental strand, 6894069 - 6893932
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaaa--ttttgttt |
426 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||||||||||| ||||||||||| |||| || ||||||||||||||||||| |||||||| |
|
|
| T |
6894069 |
ggctaaaatatgtttttggtccttgcaaatatgacgagtttaggttttggtccctggtaaaaaaaaaatttgaaattcatccctgcaaaattttttgttt |
6893970 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||| ||| | |||||| ||| ||||||| |
|
|
| T |
6893969 |
tttaaaatagtcattgaccccactttattgatgatttg |
6893932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 332 - 389
Target Start/End: Complemental strand, 3205159 - 3205102
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
3205159 |
ctaaaatatgcttttgatccctgcaaatatgatgagtttgggttttggtccctggtaa |
3205102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 3936576 - 3936637
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
3936576 |
aaggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtccctggtaa |
3936637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 332 - 452
Target Start/End: Complemental strand, 15604114 - 15603993
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgtttttt |
429 |
Q |
| |
|
||||||| || ||||||| |||||||||||| ||||||||||||||||||| | |||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
15604114 |
ctaaaatgtgtttttggt-cctgcaaatatggcgagtttgggttttggtccctagtaaaaaaaaaattgaaattcatccctgcaaaattttttatttttt |
15604016 |
T |
 |
| Q |
430 |
aaaatagtccttgggctcacttt |
452 |
Q |
| |
|
|||||||||||||| | |||||| |
|
|
| T |
15604015 |
aaaatagtccttggacccacttt |
15603993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 328 - 438
Target Start/End: Complemental strand, 34911889 - 34911779
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaattttgtttt |
427 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||||| ||||| ||| | |||| ||||||||||||||||||||||| |||| |
|
|
| T |
34911889 |
aaggctaaaatatgattttggtccctgcaaatatagcgagtttggattttgatccctagtaaaaaaaaaattgaaattcatccctgcaaaattttatttt |
34911790 |
T |
 |
| Q |
428 |
ttaaaatagtc |
438 |
Q |
| |
|
|||||| |||| |
|
|
| T |
34911789 |
ttaaaaaagtc |
34911779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 329 - 442
Target Start/End: Original strand, 15599764 - 15599880
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa-nnnnnnnnnngaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| ||| ||||||||||||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
15599764 |
aggctaaaatatgcttttggtccctacaaatatggcgaatttgggttttggtccccagtaatttttttttttgaaattcatccctgcaaaattttttgtt |
15599863 |
T |
 |
| Q |
426 |
ttttaaaatagtccttg |
442 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15599864 |
ttttaaaatagtccttg |
15599880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 415 - 464
Target Start/End: Original strand, 14809251 - 14809300
Alignment:
| Q |
415 |
aaaattttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
14809251 |
aaaattttgttttttaaaatagtcattggacccactttcttgctgatttg |
14809300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 27571190 - 27571129
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
27571190 |
aaggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttgatccctggtaa |
27571129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 31540495 - 31540555
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||| ||||||||||||| | |||||| |
|
|
| T |
31540495 |
aggctaaaatatgtttttggtccctgcaaatataacgaatttgggttttggtacctggtaa |
31540555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 35604417 - 35604472
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcct |
383 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||| |||||| |||| |
|
|
| T |
35604417 |
aaggctaaaatatgtttttggtttctgcaaatataacgagtttgagttttgatcct |
35604472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Complemental strand, 3938120 - 3938060
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| | ||||| ||||||||||| |||||| |
|
|
| T |
3938120 |
aggctaaaatatgcttttagtccctgcaaatatagcaagtttaggttttggtccctggtaa |
3938060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 3954051 - 3954111
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
3954051 |
aggctaaaatatgtttttggtccttgcaaatatatcgaatttgggttttggtccctggtaa |
3954111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 4565392 - 4565452
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||| || ||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
4565392 |
aggctaaaatatgtttttagtccctacaaatatagcgagtttgggttttggtccctggtaa |
4565452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 6044190 - 6044139
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcct |
383 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
6044190 |
ctaaaatatgattttgattcatgcaaatatgatgagtttgagttttggtcct |
6044139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 385
Target Start/End: Complemental strand, 18258529 - 18258472
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttg |
385 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| | |||| |||||| ||||||| |
|
|
| T |
18258529 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttg |
18258472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 468
Target Start/End: Original strand, 20416437 - 20416497
Alignment:
| Q |
407 |
atccctgcaaaattttgttttttaaaatagtccttgggctcactttcttgctgatttgtccc |
468 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| || | |||||||| ||||||||||||| |
|
|
| T |
20416437 |
atccctgcaaaaatttgttttttaaaataatcc-tgaacccactttctagctgatttgtccc |
20416497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 385
Target Start/End: Original strand, 20660946 - 20661003
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttg |
385 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| | |||| |||||| ||||||| |
|
|
| T |
20660946 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttg |
20661003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 332 - 389
Target Start/End: Complemental strand, 25254188 - 25254131
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |||||| ||| |||||| |
|
|
| T |
25254188 |
ctaaaatatgcttttggtccctgcaaatatatagagtttgagttttgatccctggtaa |
25254131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 332 - 389
Target Start/End: Complemental strand, 25317978 - 25317921
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |||||| ||| |||||| |
|
|
| T |
25317978 |
ctaaaatatgcttttggtccctgcaaatatatagagtttgagttttgatccctggtaa |
25317921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 330 - 362
Target Start/End: Complemental strand, 5104001 - 5103969
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatg |
362 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatg |
5103969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 408 - 444
Target Start/End: Original strand, 40167862 - 40167898
Alignment:
| Q |
408 |
tccctgcaaaattttgttttttaaaatagtccttggg |
444 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
40167862 |
tccctgcaaaattttgtttttgaaaatagtccctggg |
40167898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 8e-16; HSPs: 23)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 329 - 464
Target Start/End: Complemental strand, 34998201 - 34998062
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt--aannnnnnnnnngaaattcatccctgcaaaa--ttttgt |
424 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||||||||| |||| || ||||| ||||| ||||||| |||||| |
|
|
| T |
34998201 |
aggctaaaatatgcttttgatccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaaatttgaaatccatccttgcaaaattttttgt |
34998102 |
T |
 |
| Q |
425 |
tttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||| |||| ||||||||| | |||||||||||||||||| |
|
|
| T |
34998101 |
ttttaaaaaaagtccttggccccactttcttgctgatttg |
34998062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 329 - 465
Target Start/End: Complemental strand, 17517369 - 17517230
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaa--attttgtt |
425 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| |||||||| |||||||||| |||| || ||| |||||||||||||| ||||||| |
|
|
| T |
17517369 |
aggctaaaatatgtttttggtccctgcaaatatggcgagtttgagttttggtccctggtaaaaaaaaaaattgaatttcatccctgcaaatttttttgtt |
17517270 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttgt |
465 |
Q |
| |
|
|||||||||||| |||| | |||||||||| |||||||| |
|
|
| T |
17517269 |
ttttaaaatagtacttgaacccactttcttgatgatttgt |
17517230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 382
Target Start/End: Original strand, 29291358 - 29291411
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
29291358 |
aggctaaaatatgcttttggtccttgcaaatatggcgagtttgggttttggtcc |
29291411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 21165246 - 21165305
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
21165246 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgtgttttggtccctggtaa |
21165305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 389
Target Start/End: Original strand, 16995449 - 16995510
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| | || ||||||||||||||| |||||| |
|
|
| T |
16995449 |
aaggctaaaatatgtttttggtccctgcaaatataaagaatttgggttttggtccctggtaa |
16995510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 332 - 466
Target Start/End: Original strand, 17516164 - 17516301
Alignment:
| Q |
332 |
ctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggt-aannnnnnnnnngaaattcatccctgcaaa--attttgttttt |
428 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||||| || | || ||| |||||| ||||||| |||| ||||| |
|
|
| T |
17516164 |
ctaaaatatgtttttggtccctgcaaatatggtgagtttgggttttggtccctgataaattttttttttgaatttcatctctgcaaatttttttattttt |
17516263 |
T |
 |
| Q |
429 |
taaaatagtccttgggctcactttcttgctgatttgtc |
466 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
17516264 |
taaaatagtccttggacccactttcttgatgatttgtc |
17516301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 21953205 - 21953265
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| ||||| ||||||||| |||||| |
|
|
| T |
21953205 |
aggctaaaatatgcttttggtccctgcaaatatagcgaatttggattttggtccctggtaa |
21953265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 419 - 522
Target Start/End: Complemental strand, 17000244 - 17000141
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagatacttactgtaccaatttgaacacgtggcg |
518 |
Q |
| |
|
||||||||||||||| ||||| ||| | |||||||||||||||||| | | ||| || ||| |||| || | | |||||||||| ||||||| |||||| |
|
|
| T |
17000244 |
ttttgttttttaaaaaagtccctggacccactttcttgctgatttggcacatttttgcttaggtggtagctgatgactgtaccaacttgaacatgtggcg |
17000145 |
T |
 |
| Q |
519 |
caca |
522 |
Q |
| |
|
|||| |
|
|
| T |
17000144 |
caca |
17000141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 18810532 - 18810591
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
18810532 |
ggctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctggtaa |
18810591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 438
Target Start/End: Complemental strand, 1171712 - 1171601
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa-ttttgttt |
426 |
Q |
| |
|
|||| ||||||||| ||||| | ||||||||||| |||||||||| ||||||||| || ||| ||||| ||||||||||||| |||||||| |
|
|
| T |
1171712 |
aaggttaaaatatgtttttgatccctgcaaatataacgagtttggtttttggtccctgataaatttttttttgaaatccatccctgcaaaatttttgttt |
1171613 |
T |
 |
| Q |
427 |
tttaaaatagtc |
438 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
1171612 |
ttaaaaatagtc |
1171601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 464
Target Start/End: Complemental strand, 3279560 - 3279422
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgtt |
425 |
Q |
| |
|
|||| ||||||||| ||||| | ||||||||||| |||||||| ||||||| | |||||| ||||||||||||||||||| ||||||| |
|
|
| T |
3279560 |
aaggttaaaatatgtttttgatccctgcaaatatagcgagtttgaattttggttcctggtaaaaaaaaaattgaaattcatccctgcaaaattttttgtt |
3279461 |
T |
 |
| Q |
426 |
ttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||| ||| ||| | ||||||| | |||||||| |
|
|
| T |
3279460 |
ttttaaaataatccctggacccactttcgtactgatttg |
3279422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 419 - 464
Target Start/End: Original strand, 20896039 - 20896084
Alignment:
| Q |
419 |
ttttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
20896039 |
ttttgttttttaaaatagtccttgggcccactttattactgatttg |
20896084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 330 - 438
Target Start/End: Complemental strand, 20897556 - 20897447
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaatt--ttgtttt |
427 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| || ||||||||||||||| |||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
20897556 |
ggctaaaatatggttttggtccctgcaaatatagtgaatttgggttttggtccctggtaa-aaaaaaattgaaatccatccctgcaaaattcattgtttt |
20897458 |
T |
 |
| Q |
428 |
ttaaaatagtc |
438 |
Q |
| |
|
||||||||||| |
|
|
| T |
20897457 |
ttaaaatagtc |
20897447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 408 - 439
Target Start/End: Complemental strand, 19275961 - 19275930
Alignment:
| Q |
408 |
tccctgcaaaattttgttttttaaaatagtcc |
439 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19275961 |
tccctgcaaaattttgttttttaaaatagtcc |
19275930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 401 - 440
Target Start/End: Original strand, 3276437 - 3276478
Alignment:
| Q |
401 |
aaattcatccctgcaaaa--ttttgttttttaaaatagtcct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3276437 |
aaattcatccctgcaaaattttttgttttttaaaatagtcct |
3276478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 20391212 - 20391266
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
20391212 |
aaggttaaaatatgcttttggtccctgcaaatatagtgaatttgggttttggtcc |
20391266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 418 - 464
Target Start/End: Original strand, 29291451 - 29291497
Alignment:
| Q |
418 |
attttgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||| ||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
29291451 |
attttgatttttaaaatagtatttggactcactttcttgctgatttg |
29291497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 385
Target Start/End: Complemental strand, 3276356 - 3276299
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttg |
385 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| | |||| |||||| ||||||| |
|
|
| T |
3276356 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttg |
3276299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 23502235 - 23502288
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtc |
381 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| | |||| |||||||||| |
|
|
| T |
23502235 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtc |
23502288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 407 - 464
Target Start/End: Original strand, 16995530 - 16995589
Alignment:
| Q |
407 |
atccctgcaaaatttt--gttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||| | || ||||||||||||||| |
|
|
| T |
16995530 |
atccctgtaaaattttttgttttttaaaaaagtccttggccccattttcttgctgatttg |
16995589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 17000336 - 17000284
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||| |||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
17000336 |
ggctaaaatatacttttggtccctgcaaatgtagtgagtttgggttttggtcc |
17000284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 424 - 464
Target Start/End: Original strand, 26419609 - 26419649
Alignment:
| Q |
424 |
ttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
26419609 |
ttttttaaaatagtccctgggcgcactttcttgttgatttg |
26419649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 34995113 - 34995173
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||| |||| |||||||| | |||||| |
|
|
| T |
34995113 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttgagttttggttcctggtaa |
34995173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 4)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 344936 - 344996
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||| ||||||| ||||||| |||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
344936 |
aggctcaaatatgattttggtccctgcaaatatggcgagtttgggttttggtccctggtaa |
344996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 376429 - 376381
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggtttt |
377 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
376429 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttgggtttt |
376381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 329 - 458
Target Start/End: Complemental strand, 345957 - 345826
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaannnnnnnnnngaaattcatccctgcaaaa--ttttgttt |
426 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| ||| ||||||||||||||| | |||| ||||| |||||||||||| |||||||| |
|
|
| T |
345957 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttgggttttggtccctagtaattttttttttgaaatcaatccctgcaaaattttttgttt |
345858 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgct |
458 |
Q |
| |
|
||||||| |||||| | | |||||||||||| |
|
|
| T |
345857 |
tttaaaaaggtccttagacacactttcttgct |
345826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 330 - 522
Target Start/End: Original strand, 374335 - 374529
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa-nnnnnnnnnngaaattcatccctgcaaa--attttgttt |
426 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||| ||||||||||||||||||| | |||| ||||| |||||||||||| |||||||| |
|
|
| T |
374335 |
ggctaaaatatgattttgatccctgcaaatatagcgagtttgggttttggtcccttgtaatttttttttttgaaatccatccctgcaaatttttttgttt |
374434 |
T |
 |
| Q |
427 |
tttaaaatagtccttgggctcactttcttgctgatttgtcccttttatgtttatgtggcagatacttactgtaccaatttgaacacgtggcgcaca |
522 |
Q |
| |
|
||||||||||||||||| | |||||| || ||||||| | ||| || ||| ||||||| | || | |||||||| |||||||| ||||||||| |
|
|
| T |
374435 |
tttaaaatagtccttggtcccactttactgatgatttggctagtttttgcttaggtggcag-ttctgattgtaccaacttgaacacatggcgcaca |
374529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 10315 - 10374
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
10315 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtccttggtaa |
10374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 328 - 389
Target Start/End: Complemental strand, 11583 - 11522
Alignment:
| Q |
328 |
aaggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
11583 |
aaggctaaaatatgtttttggtccctgcaaatatagcgtatttgggttttggtccctggtaa |
11522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 329 - 464
Target Start/End: Original strand, 9921 - 10063
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa-----nnnnnnnnnngaaattcatccctgcaaaa--ttt |
421 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||| ||||||||| |||||| ||| ||||||||| ||||| ||| |
|
|
| T |
9921 |
aggctaaaatatgcttttgatccctgcaaatatagcgagtttggattttggtccctggtaaattttttttttttttgaatttcatccctacaaaattttt |
10020 |
T |
 |
| Q |
422 |
tgttttttaaaatagtccttgggctcactttcttgctgatttg |
464 |
Q |
| |
|
| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
10021 |
tattttttaaaaaagtccttggactcactttcttgctgatttg |
10063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 330 - 389
Target Start/End: Complemental strand, 490 - 431
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
490 |
ggctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctggtaa |
431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 331 - 382
Target Start/End: Complemental strand, 42813 - 42762
Alignment:
| Q |
331 |
gctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||| |||||||||| |
|
|
| T |
42813 |
gctaaaatatgcttttggtccttgcaaatatggcgagtttgagttttggtcc |
42762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0765 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0765
Description:
Target: scaffold0765; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 400 - 452
Target Start/End: Original strand, 1931 - 1985
Alignment:
| Q |
400 |
gaaattcatccctgcaaaatttt--gttttttaaaatagtccttgggctcacttt |
452 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
1931 |
gaaattcatccatgcaaaattttttgttttttaaaatagtccttggacccacttt |
1985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0516 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0516
Description:
Target: scaffold0516; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 1194 - 1142
Alignment:
| Q |
330 |
ggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtcc |
382 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
1194 |
ggctaaaatatatttttggtctctgcaaatatggcgagtttgagttttggtcc |
1142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 29; Significance: 0.0000008; HSPs: 2)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 4040 - 4100
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| | |||| |||||| ||||||||||| |
|
|
| T |
4040 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaa |
4100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 329 - 389
Target Start/End: Original strand, 19222 - 19282
Alignment:
| Q |
329 |
aggctaaaatatgcttttggttcctgcaaatatgacgagtttgggttttggtccttggtaa |
389 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| | |||| |||||| ||||||||||| |
|
|
| T |
19222 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaa |
19282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University