View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18694_low_14 (Length: 313)
Name: NF18694_low_14
Description: NF18694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18694_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 113 - 177
Target Start/End: Complemental strand, 31648012 - 31647948
Alignment:
| Q |
113 |
gccgtcgttcgtacatcccactattcacaagaaaacgggatgatggaggacgatgaacggaacta |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31648012 |
gccgtcgttcgtacatcccactattcacaagaaaacgggacgatggaggacgatgaacggaacta |
31647948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 240 - 292
Target Start/End: Complemental strand, 31647885 - 31647833
Alignment:
| Q |
240 |
tttcatacccacccgcaatcgttatatttcatcatcaccatcgtcgtcctccg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| | | ||||||||| |
|
|
| T |
31647885 |
tttcatacccacccgcaatcgttatatttcaccatcaccgttgccgtcctccg |
31647833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University