View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18694_low_9 (Length: 382)
Name: NF18694_low_9
Description: NF18694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18694_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 366
Target Start/End: Complemental strand, 34151205 - 34151132
Alignment:
| Q |
297 |
catttatatcttaattaattgaata--tgatttacgcttttaaatggtcaagta--gtacttttggtaacatac |
366 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34151205 |
catttatatattaattaattgaatacatgatttacgcttttaaatggtcaagtaatatacttttggtaacatac |
34151132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 74
Target Start/End: Complemental strand, 34151454 - 34151420
Alignment:
| Q |
40 |
atgaatttctatatttttggtggtaaaaaattcat |
74 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34151454 |
atgaatttctatatttttggtagtaaaaaattcat |
34151420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 74
Target Start/End: Complemental strand, 33463535 - 33463501
Alignment:
| Q |
40 |
atgaatttctatatttttggtggtaaaaaattcat |
74 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
33463535 |
atgaatttttatatttttggtggtaaaaaattcat |
33463501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University