View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18695_low_13 (Length: 216)

Name: NF18695_low_13
Description: NF18695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18695_low_13
NF18695_low_13
[»] chr1 (1 HSPs)
chr1 (16-198)||(49450566-49450748)


Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 49450748 - 49450566
Alignment:
16 attattcttgacatagacaccatgactctggtaataattgaagtgattaaaaaattggaagtgattgaatgtaactaattacatgtatcgatattgtgtc 115  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49450748 attattcttgacatagacaccacgactctggtaataattgaagtgattaaaaaattggaagtgattgaatgtaactaattacatgtatcgatattgtgtc 49450649  T
116 ggtgtcgaacatcggacataccattaatctgataagtgtcggtgttacattgatgatgagtgatggttagtatgatagtgttg 198  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49450648 ggtgtcgaacatcggacataccgttaatctgataagtgtcggtgttacattgatgatgagtgatggttagtatgatagtgttg 49450566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University