View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18695_low_7 (Length: 334)
Name: NF18695_low_7
Description: NF18695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18695_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 8 - 321
Target Start/End: Original strand, 9379573 - 9379886
Alignment:
| Q |
8 |
agaaaatggaggaaggaacaaatgtgaggctgaggtgaaaccaagtccttcaatggaaagatcagaacatgtacttgatgttctatcagatgatgacaca |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379573 |
agaaaatggaggaagaaacaaatgtgaggctgaggtgaaaccaagtccttcaatggaaagatcagaacatgtacttgatgttctatcagatgatgacaca |
9379672 |
T |
|
| Q |
108 |
agcataaaagttgaatactttggtttagaagatgaaactggtcttatgaattttgctgaacatgctgatggttctttaacatcaccagaagattggagtg |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379673 |
agcataaaggttgaatactttggtttagaagatgaaactggtcttatgaattttgctgaacatgctgatggttctttaacatcaccagaagattggagtg |
9379772 |
T |
|
| Q |
208 |
cttttgaatcaaatgatttattaggccaatcaagttgtgattatcaatggtgggacttttggtcttgaatgaaacagaggaggaaaatatgtgtggagga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379773 |
cttttgaatcaaatgatttattaggccaatcaagttgtgattatcaatggtgggacttttggtcttgaatgaaacagaggaggaaaatatgtgtggagga |
9379872 |
T |
|
| Q |
308 |
aatatatgcaaaat |
321 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9379873 |
aatatatgcaaaat |
9379886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University