View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18695_low_9 (Length: 312)
Name: NF18695_low_9
Description: NF18695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18695_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 40871496 - 40871354
Alignment:
| Q |
1 |
ttaaaaacaacaccgagtttgaaaggaccgaccggttcaaccaattgaactaaaaattggcgacttcattgatcaatttgatcctacttctaatgtagcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||| || |||||||||| |
|
|
| T |
40871496 |
ttaaaaacaacaccgagtttgaaaggatcgatcggttcaaccaattgaactaaaaattggctacttcattgattaatttgatcctatttttaatgtagcc |
40871397 |
T |
|
| Q |
101 |
atgatagaattatgttcaaccaggtttggtttaaccggttcgta |
144 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
40871396 |
-tgatagaatcatgttcaacccgatttggtttaaccggttcgta |
40871354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 199 - 298
Target Start/End: Complemental strand, 40871295 - 40871196
Alignment:
| Q |
199 |
tatccggtttaaatatagttgaaccaattgaactatgatttgttggtttagatttcaaaacatcgtgcaatagtgtatgaaaatattacatgatctcact |
298 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40871295 |
tatccggtttaactatagttgaaccaattgaactatgatatgttggtttagatttcaaaacatcgtgcaatagtgtatgaaaatattacatgatctcact |
40871196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University