View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18695_low_9 (Length: 312)

Name: NF18695_low_9
Description: NF18695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18695_low_9
NF18695_low_9
[»] chr2 (2 HSPs)
chr2 (1-144)||(40871354-40871496)
chr2 (199-298)||(40871196-40871295)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 40871496 - 40871354
Alignment:
1 ttaaaaacaacaccgagtttgaaaggaccgaccggttcaaccaattgaactaaaaattggcgacttcattgatcaatttgatcctacttctaatgtagcc 100  Q
    ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||| || ||||||||||    
40871496 ttaaaaacaacaccgagtttgaaaggatcgatcggttcaaccaattgaactaaaaattggctacttcattgattaatttgatcctatttttaatgtagcc 40871397  T
101 atgatagaattatgttcaaccaggtttggtttaaccggttcgta 144  Q
     ||||||||| |||||||||| | ||||||||||||||||||||    
40871396 -tgatagaatcatgttcaacccgatttggtttaaccggttcgta 40871354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 199 - 298
Target Start/End: Complemental strand, 40871295 - 40871196
Alignment:
199 tatccggtttaaatatagttgaaccaattgaactatgatttgttggtttagatttcaaaacatcgtgcaatagtgtatgaaaatattacatgatctcact 298  Q
    |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40871295 tatccggtttaactatagttgaaccaattgaactatgatatgttggtttagatttcaaaacatcgtgcaatagtgtatgaaaatattacatgatctcact 40871196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University