View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18696_high_10 (Length: 249)
Name: NF18696_high_10
Description: NF18696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18696_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 245
Target Start/End: Complemental strand, 45169569 - 45169335
Alignment:
| Q |
10 |
aaataacctttcacggatcaatttgtttagcttacagaagaacttaataatgaattttgccagtgtagcgtattaacagtaagaattcataatatgcatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45169569 |
aaataacctttcacggatcaatttgtttagcttacagaagaacttaataatgaattttgccagtgtagcgtattaacagtaagaattcataatat-catt |
45169471 |
T |
|
| Q |
110 |
tgcacacggattgaaaaagacatattgacagtcaactgggataagccatggcattcatgcatggaccatggcttatgttttcttcttccacaaactttga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45169470 |
tgcacacggattgaaaaagacatattgacagtcaactgggataagccatggcattcatgcatggaccatggcttatgttttcttcttccacaaactttga |
45169371 |
T |
|
| Q |
210 |
attatacaactgcatggttggagctttcatctcact |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45169370 |
attatacaactgcatggttggagctttcatctcact |
45169335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University