View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18696_high_5 (Length: 416)
Name: NF18696_high_5
Description: NF18696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18696_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 18 - 411
Target Start/End: Complemental strand, 39944853 - 39944451
Alignment:
| Q |
18 |
tttttatctatccaataaccttggtttatcaggtatttattgcagaaactctcaaccctgtcccatctattgtgttcatgttgttcattagctatgcttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944853 |
tttttatctatccaataaccttggtttatcaggtatttattgcagaaactctcaaccctgtcccatctattgtgttcatgttgttcattagctatgcttg |
39944754 |
T |
 |
| Q |
118 |
gtgttggtgaagggtcgtcacttggtgagaatggcggtggtggttgtagaggattgaggcctggtgatgaatgtgtaatttcttgtgtaggatcattgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944753 |
gtgttggtgaagggtcgtcacttggtgagaatggcggtggtggtggtagaggattgaggcctggtgatgaatgtgtaatttcttgtgtaggatcattgtg |
39944654 |
T |
 |
| Q |
218 |
tggtgatggtgattgtggatgttgaggctcattggttggtgagggattgtgagatggtggttgtgagggactgttgggtggtgaatgaattgttagttgt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39944653 |
tggtgatggtgattgtggatgttgaggctcattggttggtgagggattgtgagatggtggttgtgagggactgttgggtggtgaatgatttgttagttgt |
39944554 |
T |
 |
| Q |
318 |
agaggatgactaatcggtgattg---------tacttgaggatcatttattggtgaagattgtggtggttgtggagggtcaatgttttgtgatggttgtt |
408 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944553 |
agaggatgactaatcggtgattgtactagttgtacttgaggatcatttattggtgaagattgtggtggttgtggagggtcaatgttttgtgatggttgtt |
39944454 |
T |
 |
| Q |
409 |
gat |
411 |
Q |
| |
|
||| |
|
|
| T |
39944453 |
gat |
39944451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University