View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18696_low_14 (Length: 238)
Name: NF18696_low_14
Description: NF18696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18696_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 38083282 - 38083061
Alignment:
| Q |
1 |
caccaaactttagtaatttattcaagtatcattgttttaagtaaaagtaaacaaacatgtaaaaataaatacacacatagaatatctaggggttgatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38083282 |
caccaaactttagtaatttattcaagtatcattgttttaagtaaaagtaaacaaacatgtaaaaataaatacacacatagaatatctaggggttgatgaa |
38083183 |
T |
|
| Q |
101 |
tgctgcatcagatactcatccaaaaaagatgtggaaatcttcttgctcccgattgaagaagaccttgttggcatgtaatatgtaactatctctctaaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38083182 |
tgctgcatcagatactcatccaaaaaagatgtggaaatcttcttgctcccgattgaagaagaccttgttggcatgtaatatgtaattatctctctaaaaa |
38083083 |
T |
|
| Q |
201 |
tgctctttgagccttgaagcct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38083082 |
tgctctttgagccttgaagcct |
38083061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University