View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18697_high_13 (Length: 248)
Name: NF18697_high_13
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18697_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 66 - 239
Target Start/End: Complemental strand, 40398969 - 40398796
Alignment:
| Q |
66 |
atctatttatatgtgtgcatctaaataattttaatttgggattggattcaaataagacttgtttaattttggaatggaaatgttgaaatttcataaaaat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
40398969 |
atctatttatatgtgtgcatctaaataattttaatttgggattggattcaaataagacttgtttaatttttgaatggaaatgttgaaatatcataaaaat |
40398870 |
T |
|
| Q |
166 |
tagcggaggaatattgatcataaagtttgacttttgtaatacacggtggctgaattatagaggaatcttatatt |
239 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40398869 |
tagtggaggaatattgatcataaagtttgacttttgtaatacacggtgactgaattatagaggaatcttatatt |
40398796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University