View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18697_high_15 (Length: 244)
Name: NF18697_high_15
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18697_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 138 - 224
Target Start/End: Complemental strand, 5656331 - 5656245
Alignment:
| Q |
138 |
tttgttcagttggaatgatcatccatacctagcttctgatgctatagaaaatggatggtcaagatttgctttcactagctacatgag |
224 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656331 |
tttgttcaactggaatgatcatccatatctagcttctgatgctatagaaaatggatggtcaagatttgctttcactagctacatgag |
5656245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 5656468 - 5656395
Alignment:
| Q |
1 |
cttttgtttgttttcatgttgtggttttgtcatcacaaaaaagatcaaaagagatttgttgaatcaaatagctt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656468 |
cttttgtttgttttcatgttgtggttttgtcatcacaaaaaagatcaaaagagatttgttgaatcaaatagctt |
5656395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 47047669 - 47047714
Alignment:
| Q |
173 |
ctgatgctatagaaaatggatggtcaagatttgctttcactagcta |
218 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47047669 |
ctgatgctgttgaaaatggatggtcaagatttgctttcactagcta |
47047714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University