View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18697_high_16 (Length: 244)
Name: NF18697_high_16
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18697_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 33120699 - 33120521
Alignment:
| Q |
17 |
tcgatactttttaatatgtttaattgtttaattaaattcgaga-------taattaattttattaactatgtagggagcataagcaagaactctcccact |
109 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33120699 |
tcgatactttttaatatttttaattgcttaattaaattcgagaatatgtataattaattttattaactatgtagggagcataagcaagaactctcccact |
33120600 |
T |
|
| Q |
110 |
atggtcaaaagatcaacatcatcctcagtagactgaggaagcagatcacggtctgtcgtcaacaaataggtcagtaaat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33120599 |
atggtcaaaagatcaacatcatcctcagtagactgaggaagcagatcacggtctgtcgtcaacaaataggtcagtaaat |
33120521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University