View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18697_low_14 (Length: 250)
Name: NF18697_low_14
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18697_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 104 - 240
Target Start/End: Complemental strand, 46649090 - 46648955
Alignment:
| Q |
104 |
atcctgaaccttcaaccgcgaaaaactgccatttctgtcaggataaccgatcagaaagaacaaccggttaaatttgtaaatttctgaggaatacattact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
46649090 |
atcctgaaccttcaaccgcgaaaaactgccatttctgacaggataaccaatcagaaagaacaactg-ttaaatttgtaaatttctgaggaatacattact |
46648992 |
T |
|
| Q |
204 |
cgagaacgtttgggcgcgatgataaccaatccctttg |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46648991 |
agagaacgtttgggcgcaatgataaccaatccctttg |
46648955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 46651163 - 46651057
Alignment:
| Q |
1 |
ctgcacctaatgacgatgaagtggtcattctgaccaaagaaaaatatgaatggttgttgcagagg-ttgaccaggctgataagcttgaagggaagatttt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46651163 |
ctgcacctaatgacgatgaagtggtcattatgaccaaagaaaaatatgaatggttgttgcagaggcttgaccaggctgataagcttgaagggaagatttt |
46651064 |
T |
|
| Q |
100 |
acaaatc |
106 |
Q |
| |
|
||||||| |
|
|
| T |
46651063 |
acaaatc |
46651057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University