View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18697_low_16 (Length: 248)

Name: NF18697_low_16
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18697_low_16
NF18697_low_16
[»] chr4 (1 HSPs)
chr4 (66-239)||(40398796-40398969)


Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 66 - 239
Target Start/End: Complemental strand, 40398969 - 40398796
Alignment:
66 atctatttatatgtgtgcatctaaataattttaatttgggattggattcaaataagacttgtttaattttggaatggaaatgttgaaatttcataaaaat 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||    
40398969 atctatttatatgtgtgcatctaaataattttaatttgggattggattcaaataagacttgtttaatttttgaatggaaatgttgaaatatcataaaaat 40398870  T
166 tagcggaggaatattgatcataaagtttgacttttgtaatacacggtggctgaattatagaggaatcttatatt 239  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
40398869 tagtggaggaatattgatcataaagtttgacttttgtaatacacggtgactgaattatagaggaatcttatatt 40398796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University