View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18697_low_17 (Length: 245)
Name: NF18697_low_17
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18697_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 231
Target Start/End: Complemental strand, 5902337 - 5902125
Alignment:
| Q |
19 |
gtagagtacaactatcaataacatattataaagcttttattagtttattacaaaatatctcatacattcattcaaatataccttaattggtcccacccca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5902337 |
gtagagtacaactatcaataacatattataaagcttttattagtttattacaaaatatctcatacattcattcaaatataccttaattggtcccacccca |
5902238 |
T |
 |
| Q |
119 |
aaccctaacaagcccttcaccgttcattaaattaaaaaactaaagaccattggtttggcttgctcgttgaagatgccaaagtaatatttttagccccaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5902237 |
aaccctaacaagcccttcaccgttcattaaattaaaaaactaaagaccattggtttggcttgctcgttgaagatgccaaagtaatatttttagccccaca |
5902138 |
T |
 |
| Q |
219 |
cggtcctttaatt |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5902137 |
cggtcctttaatt |
5902125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University