View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18697_low_19 (Length: 244)

Name: NF18697_low_19
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18697_low_19
NF18697_low_19
[»] chr1 (1 HSPs)
chr1 (17-188)||(33120521-33120699)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 33120699 - 33120521
Alignment:
17 tcgatactttttaatatgtttaattgtttaattaaattcgaga-------taattaattttattaactatgtagggagcataagcaagaactctcccact 109  Q
    ||||||||||||||||| |||||||| ||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
33120699 tcgatactttttaatatttttaattgcttaattaaattcgagaatatgtataattaattttattaactatgtagggagcataagcaagaactctcccact 33120600  T
110 atggtcaaaagatcaacatcatcctcagtagactgaggaagcagatcacggtctgtcgtcaacaaataggtcagtaaat 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33120599 atggtcaaaagatcaacatcatcctcagtagactgaggaagcagatcacggtctgtcgtcaacaaataggtcagtaaat 33120521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University