View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18697_low_21 (Length: 237)
Name: NF18697_low_21
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18697_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 47043290 - 47043060
Alignment:
| Q |
1 |
gcatgcctttaatgatatgaaacttgtgaaatcaaaattttggcatcgaaggtaactatttactatcatattaatttaaatgaaatcaaaatttgaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47043290 |
gcatgcctttaatgatatgaaacttgtgaaatcaaaatgttggcatcgaaggtcactatttactatcatattaatttaaatgaaatcaaaatttgaagta |
47043191 |
T |
|
| Q |
101 |
tt--ctcttattctaaaattgctcaatattatggtctcactttggttttgtttaaaacagaaagcataataaagcaaatgcctttnnnnnnntaatgaaa |
198 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47043190 |
ttctctcttattctaaaattgctcaatattatggtctcactttggttttgtttaaaacagaaagcataataaagcaaatgcctttaaaaaaataatgaaa |
47043091 |
T |
|
| Q |
199 |
aatcatttgtctaattaattcaatgatgatg |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |
|
|
| T |
47043090 |
aatcatttgtctaattaatccaatgatgatg |
47043060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University