View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18697_low_22 (Length: 236)

Name: NF18697_low_22
Description: NF18697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18697_low_22
NF18697_low_22
[»] chr8 (2 HSPs)
chr8 (136-217)||(22949568-22949649)
chr8 (10-72)||(22949442-22949504)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 136 - 217
Target Start/End: Original strand, 22949568 - 22949649
Alignment:
136 caagttaactttattctatgcaagcgattagacctgcttagtaaattttaatggaattaatgtagagtaacgttgtaaataa 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22949568 caagttaactttattctatgcaagcgattagacctgcttagtaaattttaatggaattaatgtagagtaacgttgtaaataa 22949649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 72
Target Start/End: Original strand, 22949442 - 22949504
Alignment:
10 tagattatactttgaaagtttttgttatttaactaataaaatattttcgtttgaaatgaaatc 72  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22949442 tagattatactttgaaagtttttgttatttaactaataaaatattttcgtttgaaatgaaatc 22949504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University