View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18699_high_16 (Length: 245)
Name: NF18699_high_16
Description: NF18699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18699_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 41593169 - 41592952
Alignment:
| Q |
17 |
aaaaacttctgcaaatcacttaaagacaattaaaatgcacatgaacgaaagcaaaattgacacaaaacaaattatattttttgaaaggacaaaagaaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41593169 |
aaaaacttctgcaaatcacttaaagacaattaaaatgcacatgaacgaaagcaaaattgacataaaacaaattatattttttgaaaggacaaaagaaatt |
41593070 |
T |
 |
| Q |
117 |
atattgcataaaccatttatttagaaatagcctctccacttacagtaagaaccatggcgtgagcaaagagaattttgcataaattctcacctatgatttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41593069 |
atattgcataaaccatttatttagaaatagcctctccacttacggtaagaaccatggcgtgagcaaagagaattttgcataaattctcacctttgatttg |
41592970 |
T |
 |
| Q |
217 |
ctttcttccctgtcctat |
234 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
41592969 |
ctttcttccttgtcctat |
41592952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University