View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18700_low_22 (Length: 307)
Name: NF18700_low_22
Description: NF18700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18700_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 7 - 290
Target Start/End: Original strand, 28014060 - 28014343
Alignment:
| Q |
7 |
tccaagaatataaatgtttgctctccttgatgttatcagtatcatttatcttagacaattactcgatctggtgtggcaggaaaaaattctacgatatccg |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28014060 |
tccaaaaatataaatgtttgctctccttgatgttatcggtatcatttatcttagacaattactcgatctggtgtggcaggaaaaaattccacgatatccg |
28014159 |
T |
|
| Q |
107 |
gagactggttattaaccagactgtcacacctaatcaagctgttttgcattgaaaaatttctcctggcatgagtaaaagtgacaaattgtatgttgtagat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
28014160 |
gagactggttattaaccagactgtcacacctaatcaagctgttttgcattgaaaaatttctcctggcataagtaaaagtgacaaattgtgtgttgtagat |
28014259 |
T |
|
| Q |
207 |
cgttgcaattgcaaatagcaaagatcttactatcaagtttacc-tgtgaaattttttggcaatttatgcagcatatgtcagttct |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28014260 |
cgttgcaattgcaaatagcaaagatcttacaatcaagttaaccttgtgaaa-tttttggcaatttatgcagcatatgtcagttct |
28014343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University