View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18700_low_24 (Length: 268)
Name: NF18700_low_24
Description: NF18700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18700_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 246
Target Start/End: Complemental strand, 5685817 - 5685579
Alignment:
| Q |
8 |
tgagatgaactgatgcagcagaaacatgagggcaagacattgaagttcctgaaaagatattgtactttacaactcgtttatcctgaaatgtcattcgtgt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685817 |
tgagaagaactgatgcagcagaaacatgagggcaagacattgaagttcctgaaaagatattgtactttacaactcgtttatcctgaaatgtcattcgtgt |
5685718 |
T |
 |
| Q |
108 |
agggccgtctttagctgtccatgctgccaatatgtctactccaggagctgttatgtcaggctgaaaatgtccacaagttgtttgtaaatttttgaaacta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685717 |
agggccgtctttagctgtccatgctgccaatatgtctactccaggagctgttatgtcaggctgaaaatgtccacaagttgtttgtaaatttttgaaacta |
5685618 |
T |
 |
| Q |
208 |
gaataaatttattactttttatttagttatgtacacaag |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685617 |
gaataaatttattactttttatttagttatgtacacaag |
5685579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 8 - 180
Target Start/End: Complemental strand, 5698056 - 5697884
Alignment:
| Q |
8 |
tgagatgaactgatgcagcagaaacatgagggcaagacattgaagttcctgaaaagatattgtactttacaactcgtttatcctgaaatgtcattcgtgt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||| |||| |||||||||| |
|
|
| T |
5698056 |
tgagaagaactgatgcagcagaaacatgagggcaagacattgaagttcctgaaatgatattgaacttaacaactcgtttatcgcgaaaattcattcgtgt |
5697957 |
T |
 |
| Q |
108 |
agggccgtctttagctgtccatgctgccaatatgtctactccaggagctgttatgtcaggctgaaaatgtcca |
180 |
Q |
| |
|
||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
5697956 |
aggtccatctttagctgtccaggctgccaatatgtctactccaggagctgttatgtcaggctgtaaaagtcca |
5697884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University