View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18700_low_25 (Length: 261)
Name: NF18700_low_25
Description: NF18700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18700_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 24 - 251
Target Start/End: Complemental strand, 26494591 - 26494364
Alignment:
| Q |
24 |
ccaaccacctcttcaatttcctccactagcatctgttgcacgtgtttgtctttcaccaaattcgccataacccactctagtgtagttgaagttgtgtcag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494591 |
ccaaccacctcttcaatttcctccactagcatctgttgcacgtgtttgtctttcaccaaattcgccataacccactctagtgtagttgaagttgtgtcag |
26494492 |
T |
|
| Q |
124 |
ttcctgcggtgagaaactcggaacatagtgcaacaacttcaccttcgttaagcttccgtttctcctcaggtaaccgcaaattcaacaaagtatccacata |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494491 |
ttcctgcggtgagaaactcggaacatagtgcaacaacttcaccttcgttaagcttccgtttctcctcaggtaaccgcaaattcaacaaagtatccacata |
26494392 |
T |
|
| Q |
224 |
acaaataacatattcatcatcatcgtta |
251 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
26494391 |
acaaacaacatattcatcatcatcgtta |
26494364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 57 - 229
Target Start/End: Complemental strand, 26506603 - 26506431
Alignment:
| Q |
57 |
tgttgcacgtgtttgtctttcaccaaattcgccataacccactctagtgtagttgaagttgtgtcagttcctgcggtgagaaactcggaacatagtgcaa |
156 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||||| || |||||||||||| || ||||| || ||||||||||| ||||| || |||| |
|
|
| T |
26506603 |
tgttgcacatgtttgtatttgaccaaattcgccataacccactctaatgcagttgaagttgtatctgttccggcagtgagaaactccgaacacagcgcaa |
26506504 |
T |
|
| Q |
157 |
caacttcaccttcgttaagcttccgtttctcctcaggtaaccgcaaattcaacaaagtatccacataacaaat |
229 |
Q |
| |
|
||| ||| | || | |||||| |||||||||||||| ||| |||||||||||||||||| || |||||||| |
|
|
| T |
26506503 |
caagctcatcgtcatcaagctttcgtttctcctcaggcaactccaaattcaacaaagtatcgacgtaacaaat |
26506431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University