View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18700_low_26 (Length: 252)
Name: NF18700_low_26
Description: NF18700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18700_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 45075066 - 45075290
Alignment:
| Q |
18 |
ggaaaaatgagaagatcctcctgactcgtatctaaatgatagtgtgtggattagtgttctagctttgctttatttgtcaacagtttaaggatcaatttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
45075066 |
ggaaaaatgagaagatcctcctgactcgtatctaaatgatagtgtgtggattagtgttctagctttactttatttgtcaacagtttaaggatcaattgat |
45075165 |
T |
|
| Q |
118 |
atttgggcacaggcaaatgcatagcggtatatgccatgtctcatacagcaaaacaaagcaccttaataatcttggtcgaatatcaagcaaatcacccaaa |
217 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45075166 |
atttgggcacaggcaaatgcataacagtatatgccatgtcacatacagcaaaacaaagcaccttaataatcttggtcgaatatcaagcaaatcacccaaa |
45075265 |
T |
|
| Q |
218 |
actaagaggaattcaatatgagtat |
242 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
45075266 |
actaggaggaattcaatatgagtat |
45075290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University