View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18701_low_7 (Length: 262)
Name: NF18701_low_7
Description: NF18701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18701_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 246
Target Start/End: Original strand, 673323 - 673557
Alignment:
| Q |
12 |
ataggggaagaacctgttatagggtttgaggagactttacagtctaggatttggaagtttgcatacccttctgctcctggtgggttagataacgctatga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
673323 |
ataggggaagaacctgttatagggtttgaggagactttacagtctaggatttggaagtttgcatacccttctgctcctggtgggttagataaccctatga |
673422 |
T |
 |
| Q |
112 |
tcaatccattggcttctggggcacctagtttggctacacttggttgttccaagatgcttattactgctgctggaaaggatcatcttctctttagggacag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
673423 |
tcaatccattggcttctggggcacctagtttggctacacttggttgttccaggatgcttattactgctgctggaaaggatcaacttctctttagggacag |
673522 |
T |
 |
| Q |
212 |
atcagaaagatattatgaggctgtgaagaagagtg |
246 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
673523 |
atcagaaagatattttgaggctgtgaagaagagtg |
673557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University