View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18702_high_14 (Length: 241)
Name: NF18702_high_14
Description: NF18702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18702_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 16824551 - 16824342
Alignment:
| Q |
10 |
ctttttatttatgttgtaataagactatttataccttattttaatttgtaattgtgataacatttgtagttatagtgattataaatattgcagaaaattg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16824551 |
ctttttatttatgttgtaataagactatttataccttattttaatttgtaattgtgataacatttgtagttatagtgattctaaatattgcagaaaattg |
16824452 |
T |
 |
| Q |
110 |
tgataaaatattgtctaaattgaagtggtgttgcattttgttcaacatcaaaaaatttatgtcatggtcaagattgtgattgtagaaatttatttacaaa |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16824451 |
tgataaaatattgtctaaatagaagtggtgttgcattttgttcaacatcaaaaaatttatgtcatggtcgagattgtgattgtagaaatttatttacaaa |
16824352 |
T |
 |
| Q |
210 |
gctggatggg |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
16824351 |
gctggatggg |
16824342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University