View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18702_low_12 (Length: 254)
Name: NF18702_low_12
Description: NF18702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18702_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 3961861 - 3961640
Alignment:
| Q |
13 |
aatatcctataagattagaactctagatcactatttgcctcttcccccttgtatatcagaatgtggcaggcagagggtaatccgaaagagaaagctttta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3961861 |
aatatcctataagattagaactctagatcactatttgcctcttcccccttgtatatcagaatatggcaggcagagggtaatccgaaagagaaagctttta |
3961762 |
T |
 |
| Q |
113 |
ctcaattga-gatagcggaaagtagcgattttttcaaatataattttgtactatatagcacatcatggaacaatagtagtttgttgaaattccactattc |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
3961761 |
ctcaattgaggatagcggaaagtagcgattttttcaaatataattttgtactatatagcacatcatgaaacaatagcagttttttgaaattccactattc |
3961662 |
T |
 |
| Q |
212 |
aatggcgtcatagcacctctat |
233 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
3961661 |
aatggcgtcatagcaccgctat |
3961640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University