View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18702_low_18 (Length: 227)
Name: NF18702_low_18
Description: NF18702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18702_low_18 |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0179 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 3842 - 3651
Alignment:
| Q |
18 |
atgaaagataacttcaaaacgcaccaaataaaatatgcatctgggtatatgtcacctgtgtaaaaccttcttttctcttttgtccaatttttgccnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3842 |
atgaaagataacttcaaaacgcaccaaataaaatatgcatctgggtatttgtcacctgtgtaaaaccttcttttctcttttgtccaatttttgccttttt |
3743 |
T |
 |
| Q |
118 |
nnccgtagcttctttgtgataccaatgactggtgatcttcacaatcagaacagataacacaagttgagttgctacacttccaaaactgtaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3742 |
ttccgtagcttctttgtgataccaatgactggtgatcttcacaatcagaacagataacacaagttgagttgctacacttccaaaactgtaca |
3651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University