View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18703_high_7 (Length: 228)
Name: NF18703_high_7
Description: NF18703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18703_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 88 - 222
Target Start/End: Complemental strand, 42771989 - 42771855
Alignment:
| Q |
88 |
cttaacataaaatttatttatgttgttttcttttcttagtcctacattgtgtacttaggaccacaatattatgggacaggtcttacagctcttgatattg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42771989 |
cttaacataaaatttatttatgttgttttcttttcttagtcctacattgtgtacttaggaccacaatcttatgggacaggtcttacagctcttgatattg |
42771890 |
T |
 |
| Q |
188 |
aatctgtgagaaactctcattataatattcttgga |
222 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||| |
|
|
| T |
42771889 |
aatctgtgacaaactctcattataatttgcttgga |
42771855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University