View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18703_low_7 (Length: 239)
Name: NF18703_low_7
Description: NF18703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18703_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 75 - 191
Target Start/End: Complemental strand, 44681918 - 44681802
Alignment:
| Q |
75 |
ccaatatactattaaaccctaaatgtacatttgtgttgatggcgatcaagtttaaaagtattacaatatacttcgtcttgtacagagacttgattaataa |
174 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||||| | |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44681918 |
ccaatatacgattaaaccctaaatgcatgtttgtgttaacggcggtcaagtttaaaagtattacgatatacttcgtcttgtacagagacttgattaataa |
44681819 |
T |
 |
| Q |
175 |
taaaattttgccgtttt |
191 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44681818 |
taaaattttgccgtttt |
44681802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 44681992 - 44681951
Alignment:
| Q |
1 |
ctccctcctcatctcatcacacaatacagttccaccttcaac |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44681992 |
ctccctcctcatctcatcacacaatacagttctaccttcaac |
44681951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University