View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_high_41 (Length: 290)
Name: NF18704_high_41
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_high_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 6 - 260
Target Start/End: Complemental strand, 33454192 - 33453938
Alignment:
| Q |
6 |
aggagcagagaagggtaatgagaaattgataaatgaggaagggtaaaggaagtggatggatggcacgtgccattggatgggcaaaatagacaagttaggt |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33454192 |
aggagaagagaagggtaatgagaaattgataaatgaggaagggtaaaggaagtggatggatggcacgtgccattggatgggcaaaatagacaagttaggt |
33454093 |
T |
|
| Q |
106 |
ttaattgtgtgggagacatagtttctgaaaagcacccataaccgctttaaggtttggcgctgtcacttgatggtcatgttcattttccattttggtgaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33454092 |
ttaattgtgtgggagacatagtttctgaaaagcacccataaccgctttaaggtttggcgctgtcacttgatggtcatgttcattttccattttggtgaag |
33453993 |
T |
|
| Q |
206 |
cctttgatttttacaggtgttttttatgtttcgccttctttaacatgcattaata |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33453992 |
cctttgatttttacaggtgttttttatgtttcgccttctttaacatgcattaata |
33453938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University