View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_high_45 (Length: 279)
Name: NF18704_high_45
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_high_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 275
Target Start/End: Original strand, 14697801 - 14698054
Alignment:
| Q |
19 |
gaaatcggtgcatacctttgcactttatagttttctcaggttcatgtacatagcaaaagtttcagtgagtcaaagacaccaaggccttcctattgtgaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14697801 |
gaaatcggtgcatacctttgcactttatagttttctcaggttcatgtacatagcaaaagtttcagtgagtcaaagacaccaaggcattcctattgtgaaa |
14697900 |
T |
 |
| Q |
119 |
taacagattggaattgaggtgtatatatggtaacatatattgaaagaagacaaattttatttcttttagaacatatgagcaaaatttgccatcttaggat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||| |||| |
|
|
| T |
14697901 |
taacagattggaattgaggtgtatatatggtaatatatattgaaagaagacaaattttatttcttttagagc--atgagcaaaatttgctatctttggat |
14697998 |
T |
 |
| Q |
219 |
agaatgatgccaccatgccatctgcgaaaaagcttcttatatttccctttgcttctc |
275 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14697999 |
agaatgatgctaccatg-tatctgcgaaaaagcttcttatatttccctttgattctc |
14698054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University