View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_high_63 (Length: 241)
Name: NF18704_high_63
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_high_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 6474480 - 6474707
Alignment:
| Q |
1 |
caaggtccggggttcgaaccccggacacaaccaaaataaggcaggaagcgacaaataggagagtgctcattgttttacgggtcatcagtgttgacgtctt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6474480 |
caaggtctggggttcgaaccccggacacaaccaaaataaggcaggaagcgacaaataggagagtgctcattgttttacgggtcatcagtgttgacgtctt |
6474579 |
T |
 |
| Q |
101 |
tagggtcttattgtgcaggtcccccatattactcaacctatcaaaatcctaacttccaatatagtttctgatagatgttttcattgaattttaagcaatg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6474580 |
tagggtcttgttgtgcaggtcccccatattgctcaacctatcaaaatcttaacttccaatatagtttctgatagatgttttcattgaattttaagcaatg |
6474679 |
T |
 |
| Q |
201 |
gaggggcctcttcagcagtttccatgtc |
228 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
6474680 |
gagaggcctcttcagcagtttccatgtc |
6474707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 31958488 - 31958453
Alignment:
| Q |
1 |
caaggtccggggttcgaaccccggacacaaccaaaa |
36 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31958488 |
caaggtccggggttcgaaccccggacaccaccaaaa |
31958453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 21638154 - 21638189
Alignment:
| Q |
1 |
caaggtccggggttcgaaccccggacacaaccaaaa |
36 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21638154 |
caaggtccggggttcgaaccccggacaccaccaaaa |
21638189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 23730399 - 23730364
Alignment:
| Q |
1 |
caaggtccggggttcgaaccccggacacaaccaaaa |
36 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23730399 |
caaggtccggggttcgaaccccggacaccaccaaaa |
23730364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University