View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_high_64 (Length: 241)
Name: NF18704_high_64
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_high_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 47470100 - 47470312
Alignment:
| Q |
19 |
gataagtcagcgtatgtgatgagcgtgttggtgacggttacggaggcgagaacggctttggtggaggaaggagggataccggtgttggtggagattgtgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47470100 |
gataagtcagcgtatgtgatgagcgtgttggtgacggttacggaggcgagaacggctttggcggaggaaggagggataccggtgttggtggagattgtgg |
47470199 |
T |
|
| Q |
119 |
aggttgggacgcagagacataaggaaattgcggcggcgattttgttgaagatttgtgaagagaatgtgagttatcgtgtaatggtgtgtcgtgaaggtgc |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47470200 |
aggttgggacgcagagacagaaggaaattgcggcggcgattttgttgaagatttgtgaagagaatgtgagttatcgtgtaatggtgtgtcgtgaaggtgc |
47470299 |
T |
|
| Q |
219 |
tattcctcctttg |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47470300 |
tattcctcctttg |
47470312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 76 - 179
Target Start/End: Complemental strand, 5220618 - 5220515
Alignment:
| Q |
76 |
ttggtggaggaaggagggataccggtgttggtggagattgtggaggttgggacgcagagacataaggaaattgcggcggcgattttgttgaagatttgtg |
175 |
Q |
| |
|
|||||||||||||| || | ||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
5220618 |
ttggtggaggaaggtggtgtgccggtgttggttgagattgtggaggttggatcgcagagacagaaggaaattgcggcggttattctgttacagatttgtg |
5220519 |
T |
|
| Q |
176 |
aaga |
179 |
Q |
| |
|
|||| |
|
|
| T |
5220518 |
aaga |
5220515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University