View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_high_69 (Length: 238)
Name: NF18704_high_69
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_high_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 7354908 - 7355114
Alignment:
| Q |
13 |
gattatactgttttttgactatctgtttaatgttaattagatttatgtaccccttaggaccattcatggtcattggtacttgattattgttgacatggaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
7354908 |
gattatactgttttttgactatctgtttaatgttaattagatttatgtaccccttaggaccattcatggtcattggtacctgattattgtcgacatggaa |
7355007 |
T |
 |
| Q |
113 |
catggagttatctaccacttggattcttttttaactgtggattttatggaagtgagaagacgccgtattgggagaattgtaagttctgttcaagtgtacc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
7355008 |
catggagttatctaccacttggattcttttttaactgtggattttatggaagtgagaagacgccgtattaggaaaattgtaagttctgttcaattgtacc |
7355107 |
T |
 |
| Q |
213 |
aatcatg |
219 |
Q |
| |
|
||||||| |
|
|
| T |
7355108 |
aatcatg |
7355114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University