View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_high_81 (Length: 208)
Name: NF18704_high_81
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_high_81 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 68 - 191
Target Start/End: Complemental strand, 41785277 - 41785155
Alignment:
| Q |
68 |
atatttctaaattcaatatatcgatcctccaatttaaatgtttattttattcttgtatattttgaggctatatttttgataatataacaattgaaatgtt |
167 |
Q |
| |
|
|||| |||||||| ||||||| | ||||||||||| ||||||||||||| |||||| |||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
41785277 |
atatctctaaatttaatatattggtcctccaatttgaatgtttattttactcttgtgtattttgaggttata-ttttgataatataacaattgagatgtt |
41785179 |
T |
 |
| Q |
168 |
tatgtgacaacttaatcgatcaca |
191 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
41785178 |
tatgtgacaacttagtcgatcaca |
41785155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 41785396 - 41785339
Alignment:
| Q |
21 |
gtggatgattgattagtgaaccttaatgaagcataatactattaagaatatttctaaa |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785396 |
gtggatgattgattagtgaaccttaatgaagcataatactattaagaatatttctaaa |
41785339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University