View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_high_82 (Length: 207)
Name: NF18704_high_82
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_high_82 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 15 - 111
Target Start/End: Complemental strand, 36284756 - 36284660
Alignment:
| Q |
15 |
gaccacatctccatctccaatatagaggatattttcaccattttccttcacctgtatatcctttccaccacaattaacatgcaaacaacttgaatct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36284756 |
gaccacatctccatctccaatatagaggatattttcaccattttccttcacctgtatatcctttccaccacaattaacatgcaaacaacttgaatct |
36284660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University