View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_25 (Length: 394)
Name: NF18704_low_25
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 57 - 380
Target Start/End: Complemental strand, 39784832 - 39784518
Alignment:
| Q |
57 |
tacttgctagcaaatgttgcatcctttgttctctccccatcttcatggcttcaaagttgggaatatatgtcccttcatcattaaggcactgtgttcactg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39784832 |
tacttgctagcaaatgttgcatcctttgttctctccccatcttcatggcttcaaagttgggaatatatgtcccttgatcattaaggcactgt-------- |
39784741 |
T |
 |
| Q |
157 |
tagccactcaccatacctcctatgcttgcgactgaacttatagagagcctgagcatcatgagaaacctcaaatgcaacagttgatcattgccaacaaatt |
256 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
39784740 |
-aggcactcaccatacctcctatgcttgcgactgaacttatagagagcctgagcatcatgagaaacctcaaacgcaacagctgatcattgccaacaaatt |
39784642 |
T |
 |
| Q |
257 |
aagtcacccnnnnnnnnacgatttggatcttattaatatgtacctaatttctagctaattgttataaccaattggtaactgtattactataaaataacat |
356 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784641 |
aagtcacccttttttttacgatttgggtcttattaatatgtacctaatttctagctaattgttataaccaattggtaactgtattactataaaataacat |
39784542 |
T |
 |
| Q |
357 |
tattcggttaattaggcttaactt |
380 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
39784541 |
tattcggttaattaggctttactt |
39784518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University