View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_52 (Length: 259)
Name: NF18704_low_52
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 27782745 - 27782984
Alignment:
| Q |
1 |
acagaattaagtagcaaggaaatttctttgtttcaaggtcattgtttatgcgagaatatgaaaaattaaaagagcaacatacaaggaacttcttttcaag |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27782745 |
acagaattaagtagcaagggaatttctttgtttcaaggtcattgtttatgcgagaatatgaaaaattaaaagagcaacatacagggaacttcttttcaag |
27782844 |
T |
 |
| Q |
101 |
gtcattgtcccttaannnnnnnnnnnnnnnnnnnnnnctgtcatttgcaaatgagattataaagcttagggccaaacaagttgcaaggttaaacaatgcc |
200 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27782845 |
gtcattgtcccttaatttttgttttaatttttattttctttcatttgcaaatgagattataaagcttagggccaaacaagttgcaaggttaaacaatgcc |
27782944 |
T |
 |
| Q |
201 |
tgataagagtttataaaaaatgtcactatataaaaacata |
240 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
27782945 |
tgataagagtttataagaaatgtcacgatataaaaacata |
27782984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University