View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_54 (Length: 253)
Name: NF18704_low_54
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 7110411 - 7110189
Alignment:
| Q |
18 |
aaagttttcaatactcttaatcatactatttgcattcacgg---ctagagagactatagctattattaacaataacgtgcaggctccaactctaccaatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||| ||||||||||| |||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
7110411 |
aaagttttcaatactcttaatcatactacttgcattcgcggtggctagagagactgtagcta------acaataaggtgcaggctccaactctaccaatc |
7110318 |
T |
|
| Q |
115 |
ttgcttcgccatacaacagtttatattatcaatatggtgaaggctccaaatccaacacccttgactcttcgttgccaatctaaagatgacgatcttgaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7110317 |
ttgcttcgccatacaacagtttatattatcaataaggtgaaggctccaaatccaacacccttgactcttcgttgccaatctaaagatgacgatcttgaag |
7110218 |
T |
|
| Q |
215 |
aacaaacaatccattataaaacacaggtt |
243 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
7110217 |
aacatacaatccattataaaacacaggtt |
7110189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 7116506 - 7116451
Alignment:
| Q |
22 |
ttttcaatactcttaatcatactatttgcattcacggctagagagactatagctat |
77 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
7116506 |
ttttcaatactactaatcatactagttgcattcgtggctagagagactatagctat |
7116451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 174 - 207
Target Start/End: Original strand, 9036816 - 9036849
Alignment:
| Q |
174 |
cttgactcttcgttgccaatctaaagatgacgat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9036816 |
cttgactcttcgttgccaatctaaagatgacgat |
9036849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University