View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_55 (Length: 252)
Name: NF18704_low_55
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 40960471 - 40960267
Alignment:
| Q |
13 |
caaagggagagagagcataaatcagtaattaagaagacgcatgtacatcatgcttttcttttagaatacatgtcatgttttattttattttattcatgta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960471 |
caaagggagagagagcataaatcagtaattaagaagacgcatgtacatcatgcttttcttttagaatacatgtcatgttttattttattttattcatgta |
40960372 |
T |
|
| Q |
113 |
tataagttgcatgcgcccagcccaaatttttgcatcaagcctttggagaagcaggaggaggattataacctgaaagagtcacagttatactaaacatgat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960371 |
tataagttgcatgcgcccagcccaaatttttgcatcaagcctttggagaagtaggaggaggattataacctgaaagagtcacagttatactaaacatgat |
40960272 |
T |
|
| Q |
213 |
tagca |
217 |
Q |
| |
|
||||| |
|
|
| T |
40960271 |
tagca |
40960267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 174
Target Start/End: Complemental strand, 40953798 - 40953722
Alignment:
| Q |
95 |
ttttattttattcatgtatataagttgcatgcgcccagcccaaatttttgcatcaagcctttggagaagcaggaggagga |
174 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||| ||||| |||||||||||||||||| |||||| |||| ||||| |
|
|
| T |
40953798 |
ttttattttattcatatatataagttccatgcgcc---cccaattttttgcatcaagcctttagagaaggaggatgagga |
40953722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 139 - 194
Target Start/End: Complemental strand, 40954279 - 40954224
Alignment:
| Q |
139 |
tttttgcatcaagcctttggagaagcaggaggaggattataacctgaaagagtcac |
194 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40954279 |
tttttgcataaagtcttcggagaagcaggaggaggattataacctgaaagaatcac |
40954224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University