View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_56 (Length: 250)
Name: NF18704_low_56
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_56 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 33907695 - 33907458
Alignment:
| Q |
14 |
aggccgaacgacaatcacaagggacacgatgttaatgttttggcccataaccaatgcaatggtgtaaactttaccaaccaccacaatagcaacgttgtgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907695 |
aggccgaacgacaatcacaagggacacgacgttaatgttttggcccataaccaatgcaatggtgtaaactttaccaaccaccacaatagcaacgttgtgt |
33907596 |
T |
|
| Q |
114 |
tgaaatattgcaaccaattaggttgaccacaacgtcaaccaagtggtt-aacagtccttcaatatgtttggcttcaacgcagggatacaccaacccatcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907595 |
tgaaatattgcaaccaattaggttgaccacaacgtcaaccaagtggttaaacaggccttcaatatgtttggcttcaacgcagggatacaccaacccatcg |
33907496 |
T |
|
| Q |
213 |
ttctatacattctcgtttcgagaatggatacaacaggc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907495 |
ttctatacattctcgtttcgagaatggatacaacaggc |
33907458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University