View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_60 (Length: 246)
Name: NF18704_low_60
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 28340806 - 28340581
Alignment:
| Q |
1 |
ttgagacattgatcaatttatttgcatttgaaacaaaggtgaatttcggaaaagcagatcgcaggttgtaactcgaaggatatgaagcttcgaaaattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28340806 |
ttgagacattgatcaatttatttgcattcgaaacaaaggtgaatttcggaaaagcaaatcgcaggttgtaactcgaaggatatgaagcttcgaaaattga |
28340707 |
T |
|
| Q |
101 |
agaaagtcgggggnnnnnnnnnnnnnnnnnnnnttcttaacctaattgttaagaaggaaggggaagcagttaagagtgaggtgaaaagtgagcagatcag |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28340706 |
agaaagtcggggg--gagagagagagagagagattcttaacctaattgttaagaaggaaggggaagcagttaagagtgaggtgaaaagtgagcagatcag |
28340609 |
T |
|
| Q |
201 |
tgagcactcgcaactccgagtgggttgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28340608 |
tgagcactcgcaactccgagtgggttgt |
28340581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University