View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_66 (Length: 242)
Name: NF18704_low_66
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 225
Target Start/End: Complemental strand, 33907355 - 33907138
Alignment:
| Q |
8 |
taagaaactgcaacgatgtatggtcatgttgaacttgtttgaatgttttgtggaagttgtgatgtaatagcatctagttctgttgtgtgagtgtcaccta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907355 |
taagaaactgcaacgatgtatggtcatgttgaacttgtttgaatgttttgtggaagttgtgatgtaatagcatctagttctgttgtgtgagtgtcaccta |
33907256 |
T |
|
| Q |
108 |
tgtataataactaggtcgagaaagtctaggttgttgtaactaggatctagaattcaaagtttataggtactatatataaaactttgtgattatgaatctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907255 |
tgtataataactaggtcgagaaagtctaggttgttgtaactaggatctagaattcaaagtttataggtactatatataaaactttgtgattatgaatctt |
33907156 |
T |
|
| Q |
208 |
caaagttcatatttgaaa |
225 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33907155 |
caaagttcatatttgaaa |
33907138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 115 - 159
Target Start/End: Complemental strand, 33939094 - 33939050
Alignment:
| Q |
115 |
taactaggtcgagaaagtctaggttgttgtaactaggatctagaa |
159 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
33939094 |
taactaggtcgagaaaatctaggttgttacaacgaggatctagaa |
33939050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University