View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_67 (Length: 242)
Name: NF18704_low_67
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 274841 - 275067
Alignment:
| Q |
1 |
tccagcattgatgtgggaagtttttctggtgtttataattatctctcagatgatatacaagttgagagggtggtcaaggaggctgagagattttcaaagg |
100 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||||||||||| |||||| |||| ||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
274841 |
tccagcattgatgtgggaagctgttccggtgtttataattatctcttggatgatgtacaggttgagaggatggtcaatgaggctgagagattttcaaagg |
274940 |
T |
 |
| Q |
101 |
aggacaaggagaagagggatgcaatagacacaaagaaccaggcagactctgttgtctaccagactgagaagcaattgaaagagctgggagaaaaggtacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
274941 |
aggacaaggagaagagggatgcaatagacacaaagaatcaggcggactctgttgtctaccagactgaaaagcaattgaaagagctaggagaaaaggtacc |
275040 |
T |
 |
| Q |
201 |
cgactctgtgaaagagaaggtggaagc |
227 |
Q |
| |
|
| | |||||||||| ||||| ||||| |
|
|
| T |
275041 |
tggccctgtgaaagaaaaggttgaagc |
275067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University