View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_75 (Length: 237)
Name: NF18704_low_75
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_75 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 16 - 129
Target Start/End: Complemental strand, 5719180 - 5719067
Alignment:
| Q |
16 |
ataaaagagtgtgatatctagctagctagctatactaatgtaagttcaatatatagnnnnnnnaattcatcatctatatagtttttctctcattcttttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5719180 |
ataaaagagtgtgatatctagctagctagctatactaatgtaagttcaatatatagtttttttaattcatcatctatatagtttttctctcattcttttc |
5719081 |
T |
|
| Q |
116 |
ttcccttgcatcat |
129 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5719080 |
ttcccttgcatcat |
5719067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 153 - 219
Target Start/End: Complemental strand, 5719045 - 5718979
Alignment:
| Q |
153 |
gatggattcttttaaacaaatctggggtgcagcagaaggatgtagcagtagtgaatctggttggact |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5719045 |
gatggattcttttaaacaaatctggggtgcagcagaaggatgtagcagtagtgaatctggttggact |
5718979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University