View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_79 (Length: 232)
Name: NF18704_low_79
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_79 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 15380735 - 15380932
Alignment:
| Q |
17 |
cacagagcagttatatcaattgggttgaaactttggaatctgaactatttcttataatgggtttttcttagtcaatctcctcattttggacagtatgctt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380735 |
cacagagcagttatatcaattgggttgaaactttggaatttgaactatttcttataatgggtttttcttagtcaatctcctcattttggacagtatgctt |
15380834 |
T |
 |
| Q |
117 |
tcttctttcaacttgcacaagtcactttgatgggatcccacagttnnnnnnnntgttactagtagtaagttgaagctagctgcattgtgtggactttt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380835 |
tcttctttcaacttgcacaagtcactttgatgggatcccacagttaaaaaaaatgttactggtagtaagttgaagctagctgcattgtgtggactttt |
15380932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University